Latest safety machine repair Tenders | Government safety machine repair Tenders

State Government

CTN :42418499

13 Nov, 2025 2.00 Crore

Chandigarh - Chandigarh

Tender For supply of mechanical ventilator,disposable inbuilt dual heater wire and humidifier chamber ventilator circuit infant size,disposable inbuilt dual heater wire and humidifier chamber ventilator circuit pediatric size,niv mask non vented infant,niv mask non vented pediatric,niv mask vented infant,niv mask vented pediatric,disposable flow sensors if proximal flow sensor is required,heated humidifier,pediatric test lung,oxygen cell,reusable expiratory valve or cassettee,disposable expiratory bacterial or viral filter,disposable nebulizer kit,etco2 adaptor,high flow nasal cannula infant,high flow nasal cannula pediatric,cmc for first year,cmc for second year,cmc for third year,cmc for fourth year,cmc for fifth year,cmc for sixth year,cmc for seventh year,cmc for eight year

CTN :42411082

01 Nov, 2025 NA

Alwar - Rajasthan

Tender For supply of pulse oximeter,rechargeble cell aa,oxygen flowmeter,bp moniter mercury,vital bp cuff,vital bp cuff with bladder

State Government

CTN :42402124

11 Nov, 2025 NA

Thiruvananthapuram - Kerala

Tender For supply of main board for agilia sp syringe pump,force sensor for agilia sp syringe pump,battery for agilia sp syringe pump,display for agilia sp syringe pump,keypad for agilia sp syringe pump,flow sensor cable for sle 4000 to 5000,flow sensor for sle 5000 hf ventilator,oxygen cell for sle 4000 to 5000,power supply board for injectomat agilia syringe pump,disengagement lever switch for agilia for injectomat agilia syringe pump,force sensor with cable for injectomat agilia syringe pump,keypad cover kit,display board for injectomat agilia syringe pump,rechargable batteery pack 6 v for syringe pump injectomat agilia

State Government

CTN :42305516

05 Nov, 2025 NA

Chandigarh - Chandigarh

Tender For supply of icu ventilator high end c c - icu ventilator high end , humidifier servo controlled with digital monitoring of inspired gas temperature with heating wire , reusable humidifier chamber , oxygen cell or sensor , trolley for each ventilator with circuit holding arm , air and oxygen hose , disposable breathing circuit adult , disposable breathing circuit pediatric , reusable and autoclavable silicon breathing circuit adult , reusable and autoclavable silicon breathing circuit pediatric , niv mask reusable small , niv mask reusable medium , niv mask reusable large , reusable flow sensor adult , reusable flow sensor neonatal , disposable flow sensor adult , disposable flow sensor neonatal , disposable hme filter adult , disposable hme filter pediatric , exhalation valve or expiratory cassette reusable autoclavable , exhalation valve or expiratory cassette disposable , disposable t type nebulizer kit , cmc first year , cmc second year , cmc third year , cmc fourth year , cmc fifth year , cmc sixth year , cmc seventh year , cmc eighth year

Central Government/Public Sector

CTN :42306399

05 Nov, 2025 21.34 Lacs

Bhimtal - Uttarakhand

Tender For supply of component hrp membrane substrate , 3 3 diaminobenzidine , ammonium persulfate , cobalt ii chloride , yepd broth granulated 500g , ypd yepd growth agar 500g , ypd yepd growth medium , yeast nitrogen base ynb w ammonium sulphate 100g , peptone 500g , yeast extract powder , l histidine , dextrose anhydrous hi ar acs , l glutamic acid , l methionine , l lysine hi lr , l leucine , l isoleucine , 10x tris glycine sds gel running buffer , 2 5x tris sds buffer ph 8 8 , 5x tris sds buffer ph 6 8 , 10x transfer buffer , 5x laemmli buffer , 50x tae , rna isolation , sedgewick rafter counting chamber cell , borosilicate bod bottles , borosilicate dissolved oxygen bottles , uniflo 13mm 0 2 pes s 100 pk , uniflo 13mm 0 45 pes s 100 pk , uniflo 25mm 0 45 pes s 45 pk , uniflo 25mm 0 2 pes s 45 pk , single tubes pcr 0 2 ml transparent with attached flat cap , microcentrifuge tubes pp 0 5 ml with attached cap with lid closure , microcentrifuge tubes pp 1 5 ml with attached cap with lid closure , microcentrifuge tubes pp 2 0 ml with attached cap with lid closure , microcentrifuge tubes pp 5 ml transparent , mueller hinton agar granulated 500g , mueller hinton broth 500g , glucose yeast extract agar 500g , glucose yeast extract acetate broth 500g , agar granulated bacteriological grade 500g , nutrient agar granulated , nutrient broth granulated , d glucose anhydrous , sodium chloride , xylene for histopathology 2 5l , resazurin sodium salt 5g , z 2 cl osu 100g , mtt 1g , n phenyl 1 naphthylamine 500g , propidium iodide , wizard genomic dna purification kit 100 isolations x 300ul , wizard sv gel and pcr cleanup system 50 prep , hepes molecular biology grade free acid 100g , disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg , petridish , centrifuge tube conical bottom with lid , self standing centrifuge tube with lid , cryovial with external threaded self standing sterile , cryo box pp , rack for micro tube l , rack for micro tube , universal tube rack pp , universal tube rack , 20c mini cooler with gel filled cover , 0c mini cooler with nontoxic gel , agar powder bacteriological grade , mueller hinton agar , mueller hinton broth , tryptone soya broth soyabean casein digest medium , tryptone soya agar casein soyabean digest agar soyabean casein digest agar , steriswift disinfectant wipes , polyethylene glycol mw 6000 , sterile cotton swab , 2 10ul aerosol barrier gentip , 20 200ul aerosol barrier gentip , 100 1000ul aerosol barrier gentip , wrappup alluminium foils , biosoft tissue , kimwipes , kimberly clark , ecosafe disinfectant , centrifuge tube , petri dish , syringe

CTN :41842613

20 Oct, 2025 4.19 Lacs

Rajouri - Jammu And Kashmir

Tender For bid to ras bid to ras supply of amoxycillin cap 250 mg , ampicillin 250mg plus cloxacillin 250mg inj , cefoperazonc sodium inj 1 gm , cefoperazone sodium 1gm and sulbactum sodium 1gm inj , ceftazidime inj 1gm , ceftriaxone inj 1gm , tab cefuroxime axitel 250 mg , clarithromycin inj 500mg , sulphamethoxazole 200 mg and trimethoprim 40mg per 5ml bott of 50ml suspn , inj meropenem 500 mg vial , inj acyclovir 250 mg , zidovudine 300mg plus lamivudine 150mg tab , zidovudine 300 mg tab , nitrofurantion 100mg tab , thyroxin sodium 75 mcg tab , tab dapagliflozin 10mg , syp zinc 20 mg ml bott of 100 ml , tab dexamethasone 4mg , clozapine 50mg tab , inj diclofenac 75mg ml comma 1ml amp for iv bouls , human diploid cell rabies vaccine monopack , pentavalent vaccine diptheria pertusis commatetanus comma hib and hepatitis b , inj anti rabies serum ip 300 iu 5 ml , tetanus toxoid comma purified absorbed rubber capped comma vial of 5 ml 10 doses , test mantoux sufficent for 10 tests , rabies immune globulin human usp comma heat treated ampoule point ampoule containing not less than 150 iu ml of human anti rabies immunoglobulins , airway guedel comma all rubber pvc comma all sizes infant comma paediatric and adult , laryngoscope cell 1 point 5 v pencil cell , long i v line 15 g 100 cm sterile , medium and high concentration oxygen seethrough masks pvc with 7 ft point oxygen supply tubing paediatric , nasal cannula paediatric , needle spinal anaesthesia with luer lock fitting with styllet 24g ss , rapid infusion set , ibuprofen 200 mg tab , inj mesna 200mg ml , telmisartan 40mg plus amlodipine 10 mg tab , streptokinase 15 lacs iu vial inj , povidone iodine gargle bott of 100 ml , salbutamol syrup 2 mg 5ml bott of 100 ml , tube endo tracheal nasal size 4 point 0 without cuff , tube endo tracheal nasal size8 point 0 with cuff , tube endo tracheal oral with inflatable cuff tube and pilot bag 5 point 0 mm internal diameter , lignocaine hcl inj 2 percent without adrenaline vial of 30ml suitable for ophthalmic use also , febuxastat 40mg tab , oxcarbamazepine 300 mg tab , topiramate 25mg tab , torsemide 10 mg tab , tab vildagliptin 50 mg , insulin highly purified human natural inj 40iu ml comma 10 ml vial , tab sodium bicarbonate 500mg , clonazepam 0 point 5 mg tab , gloves operational size 8 pair of , vaccum blood collection tubes edta 3 ml //bid details 2 / 43

CTN :41859069

20 Oct, 2025 NA

Patiala - Punjab

Tender For bid to ras supply of medicines and lab reagents f f - tab atorvas 10 mg , tab glimepride 2 mg , tab monteleukast , inj lispro insulin , tab eltroxin 100 mcg , tab ramipril 2.5 mg , vit d 3 sachet , tab tenofovir alafinamide 25 mg , tab torsamide 20 mg , tab dopaglifozin 10 mg , tab metformin 1 gm , tab pantop 40 mg , tab omlisartan 40 mg , tab amlodipine 5 mg , tab amlodipine 10 mg , tab propanolol sr 20 mg , tab nortriptline 25 mg , tab naproxen 500 mg , tab sumatriptin 50 mg , tab tinagliptin 20 mg , tab ticagrelor 90 mg , tab rosuvastatin 40 mg , tab ranalozine 500 mg , tab clinidipine 10 mg , tab rosuvastatin 10 mg , tab premipaxole 1.5 mg , tab syndopa 125 mg , tab toltorodine tartrate 4 mg , tab montair lc , tab eltrombopag 50 mg , tab metformin 500 mg , tab leflenomide 10 mg , tab deloxitine 40 mg , tab perindopril 8 mg , tab pioglitazone 50 mg , tab glucosamine 500 mg , tab diacerine 50 mg , tab mitrazipine 7.5 mg , tab cefexime 100 mg , tab neurobion forte , tab supradine , tab etoroxib 90 mg , syrup digine , syrup citralka , examination gloves size 6.5 , ointment betamethazone gentamycin neomysin , knee splint , tennis elbow splint , shell dressing pad large non medicated , glucose strip dr morepan , inj phenargen , lithium coin cell battery 3v , edta vaccutainer for collection of blood sample , sterile vaccutrainer with silica gel for collection of blood sample , flurodie vaccutianer for collection of blood sample , dipstick urine test sugar protien , erba sgot kit , erba sgpt kit , lignocaine spray , lignocaine gel , inj lignocaine adrenaline , medical oxygen , tab losartan 50 mg , tab ondansetron 40 mg , tab ecospirin 75 mg , tab levetiracetam 500 mg , tab acamprostate 333 mg , tab telma h 52.5 , tab naltraxone 50 mg , mdi aerocort //bid details 2 / 49

Central Government/Public Sector

CTN :42336428

24 Oct, 2025 NA

Multi City - Uttar Pradesh

Tender For auction sale of others - scrap miscellaneous items (1)antivirus software,make-quick heal,03nos (2)ecg machine charger,make-bpl cardiart,01no (3)endoscope (upper gi flouro optic machine),make-pantex co. fg-29v sl no. a01335,01no (4)refrigerator,make-zenith,01no (5)refrigerator, make-lg,01no (6)fire extinguisher,26nos (7)color tv,make-samsung,01no (8)dvd player,make-samsung , 01no (9)color tv,make-lg,02nos (10)color tv,make-onida,01 (11)infra red thermometer,make-essar technologies,38nos (12)digital bp instrument, make-sinocare,50nos (13)glucometer,30nos (14)electric kettle, 05nos (15)plastic dustbin 30 liter,70nos (16)finger tip pulse oximeter,70nos (17)dustbin big,09nos (18)mannual spray machine,21nos (19)printer,make-hp,01set (20)printer,make-brother, 04set (21)printer,make-hp,06set (22)external modem, 01set (23)ups,make-intex,08set (24)ups,make-intex,01set (25)ups,make-zebronics,01set (26)ups,make-cyberpower,05set (27)computer set,01set (28)computer set,make-hcl,01set(29)computer set,make-hp,01set (30)computer set,make-hp,01set (31)computer set,make-dell,02set (32)computer set,make-acer,02set (33)pc speaker,make-zebronics,01set(34)dental chair,01no (35)x-ray holder unit,01no (36)scaler with handset,01nos (37)mirror with handle,10nos (38)tweezer,03nos (39)ball burnish,02nos (40)steel spaetula,02nos (41)forceps,12nos (42)airotar unit,01no (43)spirit lamp,01no (44)artery forceps,01no (45)x ray clip,02nos(46)hot water bag,15nos (47)b p instrument,50nos (48)torch 3 cell,10nos(49)iron bed, 27nos (50)tick wood chair without arms,08nos (51)tick wood chair with arms,03nos (52)fracture bed,02nos (53)invalid wheel chair,07nos (54)steel almirah (small),05nos (55)wooden stool,27nos (56)wooden tray,12nos (57)parda stand three folder (screen),03nos (58)kitchen trolley,01no (59)black board,01no (60)wooden box,02nos (61)tick wood screen (partition),02nos (62)reolving stool,13nos (63)collapsable coffin,10nos (64)back rest,02nos (65)steel box,01no (66)half bench,20nos (67)fracture bed frame,16nos (68)plain wooden bench without back rest,01no (69)plain wooden bench with back rest,02no (70)icu cot,4nos(71)obstetric table,1no (72)operation theatre table,1no (73)dressing trolley with glass,1no (74)iv saline stand,22nos (75)oxygen stand,18nos (76)bed side monitor stand,6nos (77)chest of drawers (04 drawers),1no (78)foot rest,2nos (79)filling cabinet,4nos (80)knock down examination table,2nos (81)instrument cabinet (steel),2nos (82)pathological wooden table,1no (83)resuscitator (adult),3nos (84)folding stretcher,1no (85)aristocrat suitcase,make-aristocrat,1no (1-85)location-drh/ddu, note-total material weight in lot-(fe-2018.87kg, ss-37.50kg, cu-4.07kg, al-1.15kg, lead acid and lithium lon-1.50kg, rubber-1.50kg, wood-416.00kg, plastic-307.083kg)

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

State Government

CTN :42181259

22 Oct, 2025 NA

Jalna - Maharashtra

Tender For supply of digital hemoglobinometer with 1000 strips , multiparameter urine strip dipstrick , glucometer with 1000 strips , rapid card tests for combined p falciparum and p vivax , ambu bag paediatric size with baby mask , iv stand , tongue depressor , b type oxygen cylinder with trolley , nebuliser , vulsellum uterine forceps curved 25o5 cm , sims retractor , sims speculum , flashlight torch box type pre focused 4 cell , weighing scale adult 125 kg per 280 ib , weighing scale baby hanging type 5 kg , digital thermometer , stethescope , foetoscope , measuring tape , bp apparatus digital , mouth mirror , snellen vision chart , tuning fork , tray instrument dressing with cover 310 195 63 mm , torch ordinary , dressing drum with cover 0.945 litres stainless steel medium and small , electric autoclave , surgical scissors straight 140 mm , sponge holder , plain forceps , toothed forceps , needle holder , suture needle straight 10 , suture needle curved , kidney tray , artery forceps , dressing forceps spiring type 160 mm stainless steel , cord cutting scissors blunt curved on flat 160 mm , emergency drug tray , surgical blade , finger pulse oxymeter , examination lamp with white light , cuscos speculum , vaccine carrier with ice packs , waste disposable bucket as per mpcb norms , domestic refrigerator 300 ltrs , chair , office chair , office table , examination table with foot step , steel almirah cuoboard storage chest , stainless steel stool , benches for patient waiting area , table , small table

Safety Machine Repair Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

State Government

State Government

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government