Latest sanitary acid Tenders | Government sanitary acid Tenders

Central Government/Public Sector

CTN :39825536

07 Apr, 2025 NA

Pondicherry - Pondicherry

Tender For purchase of o.sml micro tube rack , odc mini cooler (blood collection tube) , odc mini cooler (thermo conductive rack) (ino/pk) , odc mini cooler lsml , 1 % dithiothreitol (dtt)-1 g , 1 % dithiothreitol (dtt)-sg , i.sml float rack- 8 places , 1 dc cooler (capacity 1 or 1.8) , 10ml syringe with needle , 10ml syringe with needle (22xl 1f4) , isml centrifuge tube (soo noslpk) sterile , isml centrifuge tube amber conical bottom , 18g needle , lxphosphate buffered saline ca& mg free (sooml) , ix tris edta- ph-7.0 , 2ml screw cap micro tube conical bottom , 20ml syringe , 2ltr plastic beaker , 3% hydrogen peroxide solution , soml centrifuge tube (soonos/pk) , soml centrifuge tube (soonos/pk) racked sterile , soml centrifuge tube large volume wire racks , soml vacuum filter/storage bottle system (12nos/pk) , 8 channel multi pipette (variable) increment 1 ".d with digital , display , 8 channel multi pipette (variable) increment 11-11 with digital , display , 8 channel multi pipette (variable) increment 11-11 with digital , display , a 72s0: n-acetyl-l-cysteine (1 ogm) , absolute alcohol-sooml , absorbent cotton roll , acetic acid glacial , aluminum foil , aluminum weighing boat (100nos/pk) , amber narrow mouth bottle 30ml , amber narrow mouth bottle 8ml (72nos/pk) , antiseptic urinary towelette , apron (white lab coat) full (medium) , apron (white lab coat) full (small) , apron (white lab coat) half sleeve (medium) , apron (white lab coat) half sleeve (small) , ast 2 tube carrier set, (pack of 3) , ast 5 tube carrier set, (pack of3) , ast carrier rack 8 set , ast carrier set -5 tube , auto clave label , autoclavable biohazard bags or specimen l2x24 inches (100 , nos/pk) , autoclavable biohazard bags or specimen 19x24 inches (100 , nos/pk) , bd serum vacutainer-4ml , bd serum vacutainer-6ml , bd vacutainer edta tube-4ml (cbc and hbaic) , bd vacutainer trace element plastic (100/pk) , bd vacutainer k2 edta trace element plastic (loo/pk) , bd vacutainer k2 edta plus 6m! (100/pk) , bd vacutainer safety lock blood collection sets, 21g, , 23gx3/4"xi2 (0.8xi9mmx305mm) (50nos) , bd vacutainer safety lock blood collection sets, 23g, , 23gx3/4"xi2 (0.6xi9mmx305mm) (50nos) , beaker 1000ml (20 per case) , beaker 100ml (20 per case) , beaker 500ml (40 per case) , biohazard waste container- 5ltr , blotting paper sheet , bottle with screw cap 1000m! , bottle with screw cap 500ml , bottle with screw cap 100ml , bottle with screw cap 50ml , bp handle- long & medium , carbol fuchsin (zn, strong) , carbol fuchsin practical grade , card board cryo box 36 places for 15m! centrifuge tubes , (8nos/pk) , card board cryo box 81 places for im1l2ml vials (8nos/pk) , card board cryo box 100 places for iml/2ml vials (8noslpk) , card board cryo box 25 places for 1 m1l2ml vials (8nos/pk) , cedarwood oil , cello chiller box (3l, 8l, 12l, 14l, 20l) (without tap) , champ autoclavable variable volume pipettor (20-200ml) , chromotrope 2r , collapsible space saver rack (2 nos/pk) , combilok (4 nos/pk) , conical centrifuge tube rack (l/pack) , conical flask 100 ml , conical flask 150 ml , conical flask 250 ml , conical flask 50 ml , conical flask 500 ml , coup lin jar places-1 0 , corning 2ml external threaded polypropylene cryogenic vial , self- standing with round bottom (500/pk) , cover slip, rectangular- 22mrnx40mm , cover slip, square- 22mmx22mm , cryo apron 42" , cryo cube box 100 places (4nos/pk) , cryo cube box 25 places (8nos/pk) , cryo cube box 50 places (8nos/pk) , cryo cube box 81 places (4nos/ pk) , cryo cube box 81 places (4noslpk) , cryo gloves (medium) , cryo label nitro tag , cryo laser babies (1.28xo.50mm) , cryo marker , cryopure tubes, 2ml white, internal thread , cryo racks, (50 place) , cryo tags (l.50xo.75) , cryo vials 1.8-2ml (500nos /pk) (self-standing with external , thread) , cryo vials 1.8-2ml (500nos /pk) (self-standing with internal , thread) , cryogenic barcode label l "x 1 " , cryogenic permanent marker blue , cryo vials 1.oml, sta

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39790096

17 Apr, 2025 NA

Guwahati - Assam

Tender For empanelment of agencies for supply of different chemicals and reagents for various water testing laboratories under jal jeevan mission, assam. - ph test(i)buffer tablet ph 4.0 ar / gr grade, (ii)buffer tablet ph 7.0 ar / gr grade, (iii)buffer tablet ph 9.2 ar / gr grade, (iv)buffer tablet ph 10.01ar / gr grade, (v)ph paper strips packetsar / gr grade, tds test(i)potassium chloride ar / gr grade, (ii)whatman filter paper grade 542ar / gr grade, turbidity test(i)hydrazine sulphate (solid)ar / gr grade, (ii)hexamethylene tetramine (solid)ar / gr grade, chloride test(i)potassium chromate (solid)ar / gr grade, (ii)sodium chloridear / gr grade, (iii)silver nitratear / gr grade, (iv)n/50 silver nitrate solution (0.02 n)ar / gr grade, total alkalinity test(i)n/50 (0.02 n) sulphuric acid ar / gr grade, (ii)phenolphthalein (solid) ar / gr grade, (iii)anhyd. sodium carbonatear / gr grade, (iv)ethanol (100 % pure liquid) ar / gr grade, (v)methyl redar / gr grade, (vi)bromocresol green ar / gr grade, (vii)methyl orange solid ar / gr grade, sulphate test(i)barium chloride crystals (20-30 mesh) ar / gr grade, (ii)anhydrous sodium sulphatear / gr grade, (iii)conc. hclar / gr grade, (iv)95 % ethyl alcoholar / gr grade, (v)sodium chloridear / gr grade, (vi)glycerolar / gr grade, (vii)magnesium chloride hexahydratear / gr grade, (viii)sodium acetate ar / gr grade, (ix)glacial acetic acidar / gr grade, (x)potassium nitrate ar / gr grade, total hardness test(i)n/50 (0.02 n) edta liquid ar / gr grade, (ii)ammonium buffer solution ar / gr grade, (iii)erichrome black t (solid)ar / gr grade, (iv)triethanol amine (liquid)ar / gr grade, (v)sodium hydroxidear / gr grade, (vi)ethanol (100 % pure liquid) ar / gr grade, (vii)edta disodium salt ar / gr grade, (viii)magnesium sulphate heptahydratear / gr grade, (ix)ammonium hydroxidear / gr grade, (x)ammonium chloridear / gr grade, (xi)calcium carbonatear / gr grade, (xii)murexidear / gr grade, iron test(i)ammomium acetatear / gr grade, (ii)hydroxylamine hydrochloridear / gr grade, (iii)1,10 phenathroline monohydratear / gr grade, (iv)ferrous ammonium sulphatear / gr grade, (v)conc sulphuric acid ar / gr grade, (vi)conc. hclar / gr grade, (vii)glacial acetic acidar / gr grade, (viii)potassium permanganatear / gr grade, (ix)sodium acetate ar / gr grade, (x)potassium iodide (solid) ar / gr grade, arsenic test(i)stannous chloride (solid)ar / gr grade, (ii)lead acetate (solid)ar / gr grade, (iii)silver diethyldithiocarbamate (solid powder) ar / gr grade, (iv)glass wool ar / gr grade, (v)conc. hclar / gr grade, (vi)standard arsenic solution (1000 ppm)ar / gr grade, (vii)morpholine solution (liquid)ar / gr grade, (viii)chloroform (liquid)ar / gr grade, (ix)acetone liquid ar / gr grade, (x)sodium borohydridear / gr grade, (xi)calcium chloride anhydrous ar / gr grade, fluoride test(i)tisab-iiiar / gr grade, (ii)sodium chloridear / gr grade, (iii)glacial acetic acidar / gr grade, (iv)sodium hydroxidear / gr grade, (v)ctda (trans 1,2-diaminocyclohexane n,n,n,n tetraacetic acid)ar / gr grade, (vi)reference electrode solutionar / gr grade, (vii)spadnsar / gr grade, (viii)zirconyl chloride octahydrate (zrocl2 8h2o)ar / gr grade, (ix)anhydrous sodium fluoride (naf)ar / gr grade, (x)sodium arsenite (naaso2ar / gr grade, (xi)ureaar / gr grade, nitrate test(i)anhydrous sodium sulphite ar / gr grade, (ii)antimony metalar / gr grade, (iii)chloroformar / gr grade, (iv)potassium nitratear / gr grade, (v)conc. h2so4ar / gr grade, (vi)conc hclar / gr grade, (vii)chromotropic acid (crystal)ar / gr grade, (viii)acetic acid (glacial)ar / gr grade, free residual chlorine (new methode)(i)anhydrous disodium hydrogen phosphate (na2hpo4)ar / gr grade, (ii)potasium dihydrogen phosphate (kh2po4)ar / gr grade, (iii)disodium edta dihydrate (c10h14n2o8na2. 2 h2oar / gr grade, (iv)n,n-di-ethyl 1,4- phenylenediamine sulphate (dpd)ar / gr grade, (v)pottassium iodide, crystalar / gr grade, (vi)sulphuric acid (h2so4)ar / gr grade, (vii)sodium hydrox

CTN :39786118

26 Mar, 2025 95.00 Lacs

Phalodi - Rajasthan

Tender For corrigendum : e tender for lab items - drabkin solution for hb estimation, tlc dilueting fluid, tlc pipette, dlc diluting fluid, dlc pipette, platelate count fluid, esr pipette disposable, anti a sera, anti b sera, anti d sera ( igg & igm), anti human globulin ( coombs reagent), normal saline, test tube glass 12 x75, test tube glass 12x100, droper plastic, slide pkt iso mark, cover slips 18x18, giemsa stain, leishman stain, paraffin oil, slide tray aluminum, distilled water, methanol, reticulocyte count fluid, methylene blue soln, brilliant cresyl blue soln, eosinophill count fluid, hemocytometer ( counting chamber ), bt ct capillary, filter paper, stop watch/timer, alcohol swabs, sickling test for sickle cell anemia, sickling rapid test for sickle cell anemia, nestroft test for screening of thalessemia, dcip for screening for hbe hemoglobinopathy, quantitative test g6pd deficiency, malaria rapid card test, pt reagent, sodium citrate tube for pt test, aptt reagent, calcium chloride soln, hcg ( pregnancy card), urine strips for ph,sg,tlc,glu,bil,uro,ketone,protein,nitrate, urine container plastic 30ml, test tube disposable plastic 12x100 ( 4 " ), urine strips for microalbumin, urine strips for acr, test kit for stool for ova and cyst, test kit for occult blood, semen diluting fluid, dengue rapid card test (igg,igm & ns1 ag combo), typhoid card test antibody, rpr /vdrl test for syphilis ( rapid card tests), rapid test card for the simultaneous detection of malara pv/pf antigen, s.thphi ( igm antibodies) and dengue ns1 antigen from a single card ( combo), hiv rapid card test with single step procedure ( serum and plasma), hbsag rapid card test 0.1 iu/ml senstivity, anti hcv rapid card test, rapid test card for the simultaneous detection of hiv 1& 2,hcv,hbsag ,syphilis from a single card ( combo), afb stain kit, widal test kit, blood sugar kit, gtt test kit, bilirubin total & direct kit, creatinine kit, urea test kit, uric acid test kit, sgpt test kit, sgot test kit, alkanine phosphate test kit, total protein test kit, albumin test kit, globulin test kit, total cholesterol test kit, triglycerides test kit, vldl direct test kit, hdl direct test kit, ggt test kit, amylase test kit, iron test kit, tibc test kit, hba1c test kit, s.calcium kit, s.magnesium test kit, acid phosphatest test kit, grams stain soln, thorat swap for diphitheria, visual inspection acetic acid, rk 39 for kala azar by rapid card test, smear for filaria, montex test 5tu, montex test 10tu, tuberculin syring for montex test, troponin i rapid card test, trop t rapid card test, ra quantitative test kit, crp quantitative test kit, aso quantitative test kit, blue tips, clot activator non vaccum tube double cap, edta nonvaccum tube double cap, jsb stain 1, jsb stain 2, keto stix, lugol iodine, methanol 5ltr, microscope bulb, printer paper roll 57mmx10mtr, printer paper roll 57mmx20mtr, sodium citrate soln, sodium hypochlorite soln, tissue paper roll, urine strips 04 parameter, yellow tips, electrolyte analyzer as per enclsoed technical specifications, 5 part hematology analyzer as per enclosed technical specifications, fully automated immunoassay analyzer ( clia) as per enclosed technical specifications, semi automated bioschemistry analyzer as per enclosed technical specifications

CTN :39798795

27 Mar, 2025 7.50 Lacs

Sirohi - Rajasthan

Tender For supply of lab items zoology gc reodar- el'plectella,, scyi'ha, hyalonema, spongllla, euspongia, metrldlum, aurelia,, alcyonium,, physalia,, corallium, gorgonia,, pennatula,, madrepora,, enterobius, dugesia, fasciola, taenia, schistosoma, dracunculus, ascaris (male and female), wucheraria, peripatus., nereis, heteronereis,, aphrodite,, arenicola,, chaetopterus, hirudin aria., onychophora :, limvlus,, aranea,, palajvfnaeus,, lepas,, balanus,, apus, sacculina, eupagurus,, carcinus, lepisma, pediculus, bombyx, apis, cimex,, julus,, scolopendra,, ixodes, mytilus., chiton., teredo., turbinella,, laviculus, limax, doris, aplysla, dentalium, nautilus, sepia, octopus, loligo, pecten, solen., pinctada, asterias, pentaceros., antedon., ophiothrjx., holothurla, hemichordata:, l.balanoglo us, 2.saccoglossus., urochordata- ciona, pyrosoma. doliolum salpa, cephalochordata- amphioxus, agnatha- petromyzon. ammocoete larva, pisces -echeneis., sphyr-na., torpedo., pristls., anabas., hippocampus., chjmaer-a.., anguilla,, protopterus, ampidbia, ichthyophts., axolotl larva, . salamander,, bufo., plpa., amphiuma, alytes, trionyx, calotes., varanus., phrynosoma,, heloderm . .<\,, vip era., typhlops, bungarus., hydrophis, eryx., aves-, p lttacula,, passer, bubo,, model of archaeopteryx, mammals, felis, erinaceous,, hystrlx crocedura,, manis, acinonyx juba tus,, equus caballus, mschus moschiferous., columba livia,, pteropus, dr.a,co,, exocoetus,, chamaeleon,, perlpetus, spinel' ant eater, permanent microscopic slides, protozoa, monocystis,, euglena,, noctiluca,, tr yp anosoma,, nyctotherus,, par.a,mecium,, vorticella,, blood smears showing malarial par."site., par."mecium: binary fission, conjugation, porifera, t.s. and l.s. of sycon., spicules,, spongin fffires and gemmules, coelenterata, lo belia (colony and medusa), planula, scyphistoma and ephyra larvae of aurelia,, t.s. of mesentry of metridium, pla tyhelmtnthes, mirl,cidium, sporocyst, redia and cercaria larvae of fasciola,, scolex of taenia, w.m. of mature and gravid proglottids of taenia,, hexacanth and cysticercus larvae of taenia., aschelmtnthes, t.s. of as carl (male and femlu.e), anneuda, t.s. of nereis through different regions,, parapodia of nereis and heteronereis., tro hophore larva., arthropoda:, v.s. of compound eye,, nauplllis, l oea,, megalopa larvae and mysis, mouth parts of insects, head and mouth parts of mosquioeto anapheles, head and mouth part of butterfly, t.s. of shell of la..mellidens,, glochidium larva, echinodermata, t.s.ofarm, tubefeet and pedicel la ria,, bipinnaria larva of starfish,, echlnopluteus larva., . hemichordata :tornerla larva., urochordata-, t.s. through phar ynx show1ng gonads, t.s. through caudal region., pisces, placoid,, cycloid and ctenoid scales, v.s. of skin, amphibia, v.s. of skin,, frog fertilized egg, frog unfertilized egg, frog t.s. of testis,, frog t.s. of kidney, frog-t. s. of liver, reptilia, v.s. of skin and t.s. of stomach., aves, t.s. of inte tine, t.s. of liver, t.s.ofovary, , filoplume w.m ., types of feet and cla ws in birds, mammals, i) t.s. of pancreas,, 2) t.s. of thyroid gland,, 3) l.s . of pltuitar y gland,, 4) t.s. of intestine,, 5) l.s . of kidney,, 6) t.s. of testis and ovary and v.s. of skin, t.s. of lung, embryological slides (individual), chi k embryo: w.m. is hours of incubation, chick embryo: w.m.24 hours of incubation, chick embryo: w.m 36 hours of incubation, chick embryo: w m.72 hours of incubation, chick embryo: w.m.96 hours of incura. tion, frog (disarticulated bones), rabbit bones, fowl bones, v aranus bones, alcohol - ethanol, eosin, xyelne, hemtoxylene, acetocarmin, carnoy's fluid, chloroform, glacial acetic acid, ferric chloride, nacl, sodium citrate, giemsa stain, methylene blue, distilled water, dpx, formaline, toluene,, starch, iodine solution, alcohol - stain- xylene- dpx series bottles, alcohol -st ain-xylene- dpx series stands, slide box, cover slips, alcohol lamps for slide prepara tion, petri dlsh- noj

CTN :39668047

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

State Government

CTN :39699362

07 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For supply of chemical item - 0.5m edta solution ph-8, mb grade, sterile, pack size-500ml, 1 m tris-hcl solution ph 8, mb grade, sterile, pack size-500ml, 20% sds solution, mb grade, sterile pack size-500ml, 5m sodium chloride solution, mb grade, sterile, pack size-500ml, 3m sodium acetate solution mb grade, pack size-500ml, proteinase-k(mb grade), 100mg pack size, dtt (mb grade), 25gm pack size, tris saturated phenol (mb grade), 500ml, chloroform (mb grade), 500ml pack size, isoamyl alcohol (mb grade), 500ml pack size, sodium acetate (mb grade), 500gm pack size, sodium chloride (mb grade) 500gm pack size, sds (mb grade) 500gm pack size, tris-hcl (mb grade) 500gm pack size, edta (mb grade) 500gm pack size, 2-propanol (mb grade), 1lit pack size, forensic buffer mb grade, sterile, pack size 500 ml, glacial acetic acid, mb grade, pack size 500 ml, sodium hydroxide, mb grade, 500gm pack size, glycerol, mb grade, pack size 500 ml, fta purification reagent, pack size 500 ml, hydrochloric acid, ultrapure, 500ml pack size, hand dis-infectant rub with 75% ethyl alcohol, skin softener and moisturizer, 500 ml pack size, sodium hypochlorite, 5 litre, pack size, surface sanitizer with 20% benzalkonium chloride, 0.5% cetrimide and 5 % isopropyl alcohol, 5 litre pack size, absolute alcohol ar grade, pack size-500ml, schiff s reagents ar grade, 500ml pack size, phosphate buffered saline ph 7.4, 50 tablet per pack, trimethylbenzene (tmb), pack size-25 gm, hydrogen peroxide 30% solution, pack size-500ml, haematoxylin (ehrlich) staining solution, pack size-125 ml, dpx mountant, pack size-500ml

Central Government/Public Sector

CTN :39738182

02 Apr, 2025 40.00 Lacs

Dhubri - Assam

Tender For supply of chemicals & reagents for ccl and ug laboratories of dhubri medical college & hospital on rate contract basis - mg stain, methanol, giemsa s stain, tissue roll, zn stain, glass slide, diamond pencil, slide tray, syringe 2 ml, syringe 5 ml, syringe 10 ml, syringe 20 ml, gloves 6.5, gloves 7, gloves 7.5, spirit bottle, slide storage box, paper plaster (slide paper plaster), n 95 mask, spirit lamp, stop watch, big tray, bikar 100 ml, face mask, glass slide box, coplin jar, spray sanitizer 500ml, dropper 2ml, dropper 3 ml, dropper 5ml, dpx mount, slide stand ss rod, cell pack (cell counter machine), lyser cell wdf (cell counter machine), flurocell wdf (cell counter machine), sulfolyser wdf(cell counter machine), cell clean sysmex (cell counter machine), sysmex qc- l1,l2,l3(cell counter machine), deka phan auto (laura xl urine analyser), optisol -1500(laura xl urine analyser), optisol-750(laura xl urine analyser), urinorm xl-qc(laura xl urine analyser), urinorm xl-qc(laura xl urine analyser), test tube for laura xl 12mm x 100mm urine analyser, benedicts, urine strips 10 parameters, urine pot, esr controls (30 touch cube), esr controls (30 touch cube), esr disposable pipettes, esr stand, esr transponder (30 touch cube, protime ls (automated coagulation machine), erba clean 1(automated coagulation machine), erba actime, calcium chloride (automated coagulation machine), single reaction cuvettes, erba control p (automated coagulation machine), erba control n (automated coagulation machine), distilled water, hyphochloride, semen diluting fluid, microscop slide box, edta vials, pt-inr vials, abo grouping set, blood lancet (accusure safety lancet), leishman stain ( qualigens), giemsa stain (merck), slide rack, cover slip, cover slip, methanol, xylene, human d brilliant crystal, immerson oil ( cedar wood oil), filter paper, improve neuber chamber, wbc diluting fluide, esr westergren tube, ria vials, test tube holder, pipettes, pipettes, pipettes, micro tips (100-1000 ul), micro tips (2-200 ul), micro tips (0-10 ul), hb typing / hb electrophorosis hplc ( d-10 reagents), esr and cougalation thermal paper, blood shaker toler, cell counter dlc, glass beaker, glacial acetic acid, cover slip ( blue star 22x50=25 (10 gm) central drug ware house guwahati,narengi, cover slip 18mm x 18mm (10gm), 1.5 ml sample cup (automated coagulation machine), ammonia solution, ammomium sulphat salt, sodium nitroprosside, carbon brash for h/b tube, touroniquet belt, hemoglobinometer haemometer, wbc pipette, rbc pipette, wintrobes tub, westergreen pipette, lp needle, bone marrow aspiration needle, bone marrow aspiration needle, bone marrow aspiration needle, bone marrow biopsy needle, bone marrow biopsy needle, bone marrow biopsy needle, urinometer, surgical tray with lid, litmus paper red, litmus paper blue, fixed micro pipette, fixed micro pipette, test tube, reagent bottle, at home grossing bench, grossing board, tissue provessing container, microtome blade, microtome blade, formaldehyde, distilled water, xylene (clearing), parafin wax 60 degree celcius, acetone, glycerine, tissue cassette, container (tissue collecting), copling jar (plastic), h & e stain, absolute alcohol, leveling paper, hcl (decalcification), microtome knife, surgical blade, surgical blade, measuring cylender, measuring cylender, measuring cylender, slide storage box, ada, diabetes control (bilevel), assayed chemistry control -i, assayed chemistry control -ii, immuno assay plus control -i, immuno assay plus control -ii, cardiac marker plus control - i, cardiac marker plus control - ii, eqas(external quality assurance services), desktop label printer, label 50*25*1dt per 1000, ribbon 80*75*w333, syringe & needle destroyer, room temp. meas.thermometer, digital thermometer for deep freezer, fixed micropipette, fixed micropipette, fixed micropipette, fixed micropipette, variable micropipette, variable micropipette, micro centrifuge tube, micro centrifuge tube, multi layer

Sanitary Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

State Government

Central Government/Public Sector

State Government

State Government

Central Government/Public Sector