Latest silicon oxide Tenders | Government silicon oxide Tenders

CTN :41426216

28 Oct, 2025 NA

Allahabad - Uttar Pradesh

Tender For bid to ras corrigendum : supply of neomycin tube of 20gm , oint acyclovir skin cream , oint beclomethasone salicylic acid , oint miconazole , olanzapine 2.5 mg tab , omega 3 fatty acid cap , omega fatty acid antioxidant cap , orciprenaline 10mg tab , pantaprozole 40 mg domperidone 10 mg , pcm 250 mg caffein 100 mg ergotamine 1mg prochlorperazine 2.5 tab , peglec powder 137.15gm , pentosan polysulfate sodium 100 mg tab , phenytoin sodium er 300 mg tab , pioglitazone 30mg tab , piracetam 800 mg tab , pramipexole 0.5 mg tab , pregabalin 75 mg nortriptyline 10 mg methylcobalamin 1500 mcg tab , pregabalin 75 mg ntp 10 mg tab , pregabalin 75mg methylcobalamin 750 mg tab , pregabalin sr 75 mg tab , pre-pro probiotic tab , propranol 40 mg tab , protein powder bott of 200gm , prucalopride 1 mg tab , prucalopride 2 mg tab , pyridoxin 40 mg tab , pyridoxine 20 mg tab , quetiapine sr 100 mg tab , rabeprazole 20 mg levosulpride 75mg tab , rabeprazole 20mg itopride 150mg tab , rabeprazole 20mg domeperidon 10mg tab , ranolazine sr 500 mg tab , rasagiline 0.5 mg tab , repaglinide 1mg tab , rifaximine 200mg tab , risperidone 1 mg tab , risperidone 4mg trihexphenidyl 2mg tab , rivaroxaban 2.5 mg tab , ropinirole 1 mg tab , ropinirole sr 1 mg tab , ropinirole sr 2 mg tab , rosuvastatin 10 mg tab , rosuvastatin 20 mg tab , rosuvastatin 40 mg tab , s amlodipine 2. 5 mgtab , salbutamol 4mg tab , semaglutide 3 mg tab , serratiopeptidase 10 mg tab , serratiopeptidase 5 mg tab , sertraline 25 mg tab , silodosin 8 mg dutasteroide 0.5 mg tab , sitagliptin 50 mg tab , sod picosulphate 10mg tab , sod valproate 200 mg cr tab , sodium bicarbonate 1000 mg tab , sodium chloride 6perc eye oint , sodium chloride 5perc eye drops , sodium valproate valproic acid 200 mg tab , sodium valproate 300 mg tab , sodium valproate 300 mg tab cr , sodium valproate 500 mg tab , syp alpha - amylase pepsin digestive enzyme , syp ambroxol 20m gchlorpheni 2mg dextromethorphan hydro10mg bott of 100ml , syp iron and folic acid , syp liver tonic liv-52 , syp mucaine gel bott of 200ml , tab sodium valproate 500 mg cr tab , tacrolimus 0.1 perc ointment , tacrolimus 0.25 mg tab , tadalafil 10mg tab , tamsulin 0.4 mg dutasteride 5 mg tab , tapentadol 50 mg tab , taurine 500mg acetylcystine 150mg , telmisartan 20mg tab , telmisartan 40 amlodipine 5 mg tab , telmisartan 40 mg chlorthalidone 12.5 mg tab , telmisartan 80 mg tab , tendocare tab , teneligliptin 20mg tab , thalidomide 100mg , thiocolchicoside 8 mg tab , thyroxin 100 mcg tab , thyroxin 12.5mcg , thyroxine 50 mcg tab , ticagrelor 60 mg tab , timolol maleate eye drop 0.5perc bott of 5 ml , tiotropium 18mcg rotacap , tolperisone sr 150 mg tab , tolterodine 2 mg tab , tramadol dicyclomin acetaminophen tab , tranexamic acid 500 mg mefenamic 250 mg tab , triamcinolone 0.1perc oral paste of 7.5gm , trifluoperazine 5mg tab , trypsin, chymotrypsin,diclofenac chymoral forte d tab , ubiquinol acetate 100 mg tab co q , urostomy bag 60mm , ursodexycholic acid 300mg tab , vitamin a cap , volini gel tube of 50 gm , zolpidem 5 mg tab , glucometer strip one touch ultra , glucometer //bid details 2 / 121 strip simple select , glucometer strips one touch select , hydrophobic acryl biconv iol pmma mono hep 3pc foldable iol power plus 17 to plus 24 , 4perc sodium chondrotin sulfate 1.65perc sodium hyaluronate 1ml pfs , hydroxy methyl cellulose 2perc 2 ml inj , inj moxifloxacin for inta ocular use preservative free , disposable phaco instrument set for cataract surgery , sterile disposable irrigation and aspiration cannula for cataract surgery , tab dolutegravir 50mg

CTN :42103407

27 Oct, 2025 NA

Bikaner - Rajasthan

Tender For bid to ras supply of pessary 100mg , magnesium sulphate 50 w v inj , glycopyrrolate 0 2 mg ml 1ml inj , tab sodium bicarbonate 500 mg , travoprost 0 004 with polyquad 0 001 bott of 2 5 ml eye drops , cream luliconazole tube of 15 gm , sodium chloride 0 65 w v nasal drops of 15 ml , betahistine dihydrochloride 8mg tab , syp azithromycin 200 mg per 15 ml , ondansetron syp 2 mg 5ml in bott of 30 ml , iron drops paediatric each ml contains ferrous fumarate containing 10 12 5 mg elemental iron folic acid 0 1 0 5 mg vit b12 3 10 mcg bottle of 15 ml , levo salbutamol syrup 1 mg 5ml bottle of 100 ml , bupropion hcl 150 mg sr tab , buspirone hcl 10 mg tab , quetiapine 50 mg tab , paroxetine xr 12 5 tab , disodium hydrogen syp , meropenem 1 gm inj , tab linezolid 600mg , povidone iodine 10 solution bott of 100 ml , tamsulosin hcl 0 4mg cap , vit b 12 500 mcg ml inj , iron syp bottle of 200 ml , vit d3 60000 iu per 1gm sachet , vitamin e 200 mg soft gelatin cap , ethambutol 800mg tab , hydroxychloroquine 200 mg tab , methyl prednisolone sodium acetate 80 mg inj , leflunomide 10 mg tab , nitrofurantoin 100 mg tab , tab dapagliflozin 10 mg , syp zinc 20 mg 5 ml bottle of 100 ml , paroxetine 20 mg cr tab , baclofen xl 30 mg tab , inj thiamine 100 mg ml 2 ml amp , cabergoline 0 25 mg tab , anti venom serum polyvalent dry vial of 10 ml , pmo line , abdominal binder , bandage dvt stocking s l and xl , skin stapler with staples 35 mm stainless steel , ultrasound gelly bot of 250ml , functional knee support with hinges , oint miconazol 2 of 15 gm , syp montelucast levocetrizine bot of 60ml , tab natural micronised progestron 200mg , cervical collar soft , tab moxinidine 0 3mmg , mouth ulcer gel , vit d3 drop , kit trop t , tab clindamycin100mg clotrimazol 100mg tinidazole 100 mg vaginal clingen fort , analagesic spray , cr film size 12 10 fuji , cr film size 10 8 fuji , tab enalapril 5mg , tab bisoprolol 5mg , tab bisoprolol 2 5mg , syp drotaverin bott of 60ml , syp ranitidine bott of 100ml , nebulizer mask , drop hydroxyzine 6mg , syp hydroxyzine bott of 100ml , syp cyproheptadine bott of 100ml , r c formeterol 6mcg budesonide 200mg , r c formeterol 6mcg budesonide 400mg , tab zinc 50mg , hydrocolloid dressing 10 10 , i gel s 1 , i gel s 2 , i gel s 3 , i gel s 4 , i gel s 5 , i gel s 2 5 , blood culture bott high media , tab cilindipin 10mg , rabies human monococal antibody r dna , tab leflunomide 20mg , vitamin e 400 mg soft gelatin cap , typhoid polysaccharide conjugate vaccine 0 5ml biovac tcv , inj dtap vaccine 0 5 ml , inj measels mumps rubella vaccine 0 5 ml mmr tresivac , tab ezetimibe 10mg , tab tacrolimus 0 5mg , cap evening primrose 500mg , tab citicolin 500mg , tab doxofylline 400mg , tab bilastin 20mg , tab tofacitinib 5 mg , silicon heel pad , syp liqd parafin milk magnesia cremafine , tab tadalafil 5 mg , tab piracetam 400 mg , urine container , tab clobazam 5mg , tab pyridoxine 40mg , ultrafine pen needle bd needle , tab sildenafil citrate 50mg , levosalbutamol 2 5 1 25mg respule , mdi salbutamol aerosol 200 mtr 100mcg , inj paracetamol 150 mg 2ml , inj triamcinolone acetate kenocort , syp paracetamol ibuprofen 100mg 5ml , sachet probiotic , tab acyclovir 800mg , tab lamivudine 150mg , tab dolutagravir 50mg , inj purified fsh 75 iu , cerviprime gel , abbot freestyle libre sensor , surgical blade s 11 , surgical blade s 12 , surgical blade s 20 , amiodarone hcl 200 mg tab , tab biotin 10 mg , syp probiotic , tab vitamin b complex , nortriptyline 25 mg tab , clotrimazole cream 1 tube of 15 gm , propranolol tr 40 mg tab , clotrimazole pulv 1 bott of 75 gm , clindamycin 600 mg injection 150 mg //bid details 2 / 103 ml of 4 ml , tab vitamin c 500 mg chewable , lorazepam 1 mg tab , rifampicin 450 mg tab , rifampicin 150 mg cap , rifampicin 600 mg tab , spacer with one way valve , saroglitazar 4 mg tab , soft gelatin cap antioxidant containing aronia extract 20 50 mg leutein 5 mg zeaxanthin 1 mg vit c 20 mg , acebrophylline 100 mg cap

CTN :41066150

27 Oct, 2025 55.68 Lacs

Delhi - Delhi

Tender For bid to ras supply of laboratory consumables e e - hydrogen phosphate, 500 gms , potassium phosphate monobasic, 500gms , ammonium persulphate, molecular biology reagent, 100 gms , fetal bovine serum, 500 ml , dmem low glucose, without sodium pyruvate, phenol red, 500 ml , acrylamide or bis acrylamide, 30percent, 100 gms , ripa buffer, 50ml , ficoll histopaque, 500 ml , bca protein estimation solution sigma, 1 liter , rat st2 elisa kit, 96 t , nitro blue tetrazolium chloride, 1 gms , lipopolysaccharide lps solution 500x, 100 ul , protease inhibitor cocktail 100 x, 5 ml , penicillin streptomycin, 100 ml , dextran, fluorescein, greater than 500000g permol, 250 gms , rat cd 11b fitc labelled antibody for flow cytometry , rat cd68 pe labelled antibody for flow cytometry , cd16 antibody, 100 ul , akinetic tubridometric assay kit for serum endotoxin detectionm, 96t , pe anti rat cd8a antibody, 100 ul , foxp3 monoclonal antibody fjk 16s, apc, 100 ug , ror gamma t, monoclonal antibody afkjs 9, pe, 100 ug , human t bet, alexa fluro 594 conjugated antibody , rat cd4 monoclonal antibody fitc, 200 ug , sybr green i nucleic acid gel stain, 0.5 ml , cdna synthesis kit, 200 rxns , phusion high fidelity pcr kit, 100rxn , isolation rna kit, 100 reactions , total antioxidant capacity colorimetric assay kit, 96 t , lactate dehydrogenase ldh activity assay kit, 96 t , acetic acid, 100 ml , rat d lactic acid elisa kit, 96 test , dmso for cell culture, 100 ml , sodium azide, 50 gms , western blot developer chemiliminscent substrate milipore, 2 x 25 ml , rat cd8 pe labelled antibody for flow cytometry, 25 ug , cd86 b7 of 2 monoclonal antibody gl1, pe, 100ug , cd206 monoclonal antibody mr5d3, fitc, 100ug , jam a cd321 polyclonal antibody, 100 ug , rat il13 interleukin 13 elisa kit, 96t , human myeloperoxidase elisa kit, 96 t , dithiothreitol, 100 gms , n formyl methionyl leucyl phenylalanine fmlp , l citrulline, 500 mg , sodium citrate dihydrate, 500 gms , rat maresin 1 elisa kit, 96 test , temed electrophoresis grade, greater or equal 99percent, 50 ml , rat defensin beta 2 elisa kit, 96 test , rat cathelicidin antimicrobial peptide elisa kit, 96 wells , rat mcp1 or ccl2 elisa kit, 96 wells , rat ccl4 or mip 1 beta elisa kit, 96 wells , rat cxcl 15 elisa kit, 96 wells , rat mig monokine induced by interferon gamma elisa kit, 96 test , rat ip10 interferon gamma induced protein 10kda elisa kit, 96 test , rat blc 1 b lymphocyte chemoattractant 1 elisa kit, 96 wells , rat sdf1 or cxcl 12, stromal cell derived factor 1 elisa kit, 96 test , sytox green nucleic acid stain, 5mm solution in dmso , cox 2 antibody , rat pge2 prostaglandin e2 elisa kit, 96 test rat elisa kit interleukin 6, rat elisa kit for tumor necrosis factor alpha, rat macrophage inflammatory protein-1, mip1a elisa kit, rat elisa kit for interleukin 1 beta, rat elisa kit interferon gamma, rat elisa kit transforming growth factor beta, rat elisa kit interleukin 10, rat interleukin 17, il-17 elisa kit, rat elisa kit for monocyte chemotactic protein 1, lix/cxcl5 rat elisa kit, tarc/ccl17 human elisa kit, rat mdc/ccl22 (macrophage derived chemokine) elisa kit, rat interleukin 18, il-18 elisa kit, rat interleukin 33, il-33 elisa kit, rat il-18 elisa kit, 96 test detection range 2pg/ml-600pg/ml, mouse tnf alpha elisa kit, mouse il-1beta elisa kit, mouse interleukin 6 (il-6) elisa kit, rat intestinal fatty acid binding protein elisa kit, rat zonulin elisa kit, rat lipid binding protein elisa kit, alexa fluor 564 anti rabbit secondary antibody, goat anti-rabbit igg (h+l) fluor 488 conjugated antibody, inos polyclonal antibody 100ul, nf-kb p65 antibody, zo-1 antibody, 100ul, phospho-tirap (tyr106) antibody, 100ul, //bid details 2 / 85

CTN :42353902

27 Oct, 2025 19.74 Lacs

Pithoragarh - Uttarakhand

Tender For supply of drugs and pharamceutical products d d - tab tenofovir 25 mg , tab alpha ketoanalouge 667mg , tab daflon 500mg , tab montelukast 10mg , resp.salbutamol , tab antioxidant with lycopene , tab mebeverine hydrochloride 135mg , tab levodopa 200mg plus carbidopa 50mg syndopa 250 , e d nepafenac 5 ml , syp cyproheptadine 200ml , tab lopinavir 200mg plus ritonavir 50mg , tab brivaracetam 100 mg , tab sulfasalazine 500mg , tab rabeprazole plus domperidone , tab vildagliptin 50mg , tab isosorbide dinitrate 20mg plus hydralazine 37.5mg isolazine 50mg , tab dutasteride 0.5mg , syp liver tonic liv 52 100ml , tab mesalamine 1.2gm , tab piracetam 800mg , ed brinzolamide 1 per plus brimonidine 0.2 per , tab duloxetine 20mg , tab thiocolchicoside 4mg , tab paracetamol plus diclofenac plus chlorzoxazone cipzox , lumber belt size small , brava paste colostomy 12050 , mdi levosalbutamol plus baclomethasone , cap simethicone 80mg plus activated charcoal , tab mirabegron 25 mg , tab glucosamine plus chondrotin , syp digestive enzyme 200ml , syp iron 200ml , tab acebrophylline 100mg , barrier cream colostomy 4720 , glutamine sachet , tab eplerenone 25mg , isabgol husk 3.5gm , tab vericiguat 10 mg , gluco one sugar strips pack of 50 strips dr.morpen , lumber belt size medium , lumber belt size-large , tab tramadol 50mg , respules glycopyrrolate 25mcg solution , tab pantoprazole plus domperidone , capd fluid 2.5 per pd-4 low calcium with 2.5 per dextrose , mdi tiotropium bromide , film x ray 15x12 green base , tab gliclazide 80mg , tab trypsin plus chymotrypsin chymorol forte , tab rosuvastatin 10mg , tab cilnidipine 10mg , tab cilostazole 100mg , tab pentoxyphylline 400 mg , tab nortriyptyline 25mg , tab s adenosyl lmethionine 200 mg , tab finasteride 5mg , oint betamethasone plus gentamycin , povidine iodine solution 100ml , tab antacid , sachet oral rehydration salt ors 5gm , tab zidovudine 300mg , tab tolterodine 2mg , tab isorbide mononitrate 30mg , tab sevelamer 400mg , tab prazocin 2.5mg , tab pancreatin 170mg plus dimethicone 80mg pankreoflat , tab tenofovir 300mg , tab bicalutamide 50mg , tab solifenacin 5mg , syp disodium hydrogen citrate 100 ml , tab sodium valporate plus valporic acid 500mg , tab rosuvastatin 20mg , ketoconazole shampoo 100 ml , desensitising paste stannous fluoride potassium nitrate sod monofluro phosphate tube of 50 gm , cap omega 3 fattyacid minerals , insulin soluble human regular , tab trimetazedine 35 mg mr , tab sevelamer 800mg , tab flupirtine 100mg , tab olmisartan 40mg , cap coenzyme q10 lycopene l carnitine tartrate omega 3 fatty acid vitamins , tab isosorbide mononitrate 20mg , tab doxepine 75mg , r c glycopyrinium 50mcg , tab fexofenadin 120mg , tab divalprox sodium cr.500mg , tab common cold anti cold , tab ranolozine 500mg , tab nitroglycerine 2.6mg , chlorhexidine mouth wash 100ml , tab rifaximin 400mg , tab lacosamide 100mg , nasal spray fluticasone 10 ml , tab vitamin b complex , tab losartan 50 mg

CTN :42372527

08 Nov, 2025 NA

Silvassa - Gujarat

Tender For supply of antiwear antioxidant type additive

CTN :42413944

01 Nov, 2025 1.18 Lacs

Wardha - Maharashtra

Tender For supply of cap antioxidant,cap iron folic acid zinc pyridoxin,cap karvol plus,cap omega 3 fatty acid,cap omeprazole domperidone,cap vitamin e 400mg,cap vit k7 calcitrol methylcobalamine calcium,carbolic acid crystal,clove oil,liquid hand wash bott of 200 ml,distilled water,ed beclometasone 0points 025 clotrimazoleenicol 5 lignocaine 2 candi,egel hydroxyproylmethylcellulose 0points 3percentage eye mist,nasal drop oxymetazoline ortrivin,ecg gel,ecg recording paper 80mm x 20mm,ecg recording paper 210mm x 20mm,glucometer strip accucheck,glucostrip one touch active,inj thiamine 100mg,inj methylcobalamine,inj methylcobalamine 1500mcg,inj methylcobalaminevit b6 and nicotinamide,inj neurobion,inj nor adrenaline,inj paracetamol 1gm iv infusion,ipratropium bromide resp solution vial of 15ml,lot calamine bott of 60ml,lot candid tv,lot sterillium bott of 500ml,lot sterillium bott of 100ml,lot sunscreen spf 40 la shield tube of 60 gm,lot vaginal wash bott of 100ml,lot venusia max,paediatric paracetamol suppsitories,pulv protein b,pu

Central Government/Public Sector

CTN :42418255

13 Nov, 2025 3.23 Lacs

Umiam - Meghalaya

Tender For supply of superoxide dismutase,superoxide dismutase,superoxide dismutase,superoxide dismutase,superoxide dismutase,superoxide dismutase,lipid peroxidation,lipid peroxidation,lipid peroxidation,lipid peroxidation,lipid peroxidation,lipid peroxidation,propidium iodide,propidium iodide,propidium iodide,propidium iodide,propidium iodide,propidium iodide,glutathione s-transferase assay kit,glutathione s-transferase assay kit,glutathione s-transferase assay kit,glutathione s-transferase assay kit,glutathione s-transferase assay kit,glutathione s-transferase assay kit,jc-1,jc-1,jc-1,jc-1,jc-1,jc-1,total antioxidant capacity,total antioxidant capacity,total antioxidant capacity,total antioxidant capacity,total antioxidant capacity,total antioxidant capacity

CTN :42331721

27 Oct, 2025 5.36 Lacs

Sagar - Madhya Pradesh

Tender For supply of drug and consumable g g - tab , nortriptyline 10 mg tab , novelon tab ethinyl estradiol 0.03mg and desogestrel 0.15mg , oint clobetasole 0.05per and salicylic acid 3.5per andpropylene glycol oint tube of 20gm , oint miconazole , olanzapine 10 mg tab , olanzapine 2.5 mg tab , olopatadine 0.1per bottle of 5 ml e d , omega fatty acid and antioxidant cap , omeprazole 20 mg cap , oxcarbazepine 300mg tab , pantaprozole 40 mg and domperidone 10 mg pan d , pantoprazole 20 mg tab , pantoprazole 40 mg and domperidone sr 30 mg cap , pantoprazole 40 mg and levosulpiride 75 mg cap , paradichlorobenzene ear drop clear wax , pcm 250 mg and caffein 100 mg andergotamine 1mgandprochlorperazine 2.5 vasograin tab , phenytoin sodium 100 mg eptoin , polyethelen glycol and propylene glycol systane e d , pomalidomide 2 mg tab , povidone iodine 10 per oint , povidone iodine sol 10per bottle of 100 ml , pramipexole 0.125 mg tab , pramipexole 0.25mg tab , prasugrel 10 mg tab , prednisolone 10mg tab , prednisolone 5 mg tab , pregabalin 75 mg and nortriptyline 10 mg and methylcobalamin 1500 mcg tab , pregabalin 75 mg and ntp 10 mg tab , pregabalin 75mg and methylcobalamin 750 mg tab , pregablin 75 mg , rabeprazole 20 mg tab , rabeprazole 20 mgand levosulpride 75mg tab , rabeprazole 20mg and itopride 150mg tab , rabeprazole 20mg anddomeperidon 10mg tab , ramipril 10 mg tab , ramipril 2.5mg tab , ramipril 5 mg tab , repaglinide 1mg tab , respule levosalbutamole 1.25 mg , risperidone 1 mg tab , risperidone 2 mg tab , roller bandage 10 cm , roller bandage 15 cm , rosuvastatin 10 mg tab , rotacap salmeterol 50 mcg and fluticasone 250 mcg , sacubitril 24mg and valsartan 26mg tab , salmeterol 50mcg and fluticasone propionate 250mcg , sertraline 50 mg tab , silodosin 8 mg and dutasteroide 0.5 mg tab , sitagliptin 100 mg tab , sitagliptin 50 mg tab , sitagliptin 50mg tab and metformin 500mg tab , sodium bicarbonate 1000 mg tab , sodium chloride 0.65per nasal drops nosoclear , sofosbuvir 400mg and velpatasvir 100mg cap , solifenacin 5 mg tab soliten , spironolactone 25mg tab , spironolactone 50 mgaldectone , sucralfate 1gm 5ml bott of 200 ml , sulfasalazine 500 mg tab , sumatriptan 50 mg tab , syp alpha - amylase pepsin digestive enzyme , syp antacid gel 170 ml digene gel , syp augmentin amoxy 200andclavulanic acid 28.5 , syp azithromycin 200 mg 5ml , syp cough expectorant 100 ml , syp iron and folic acid , syp lactulose 100 ml bott , syp metronidazole 60 ml , tacrolimus 0.3per oint , tamsulin 0.4 mg and dutasteride 5 mg tab urimax d tab , telmisartan 40 mg tab , telmisartan 80 mg tab , telmisartan h 40 mg and 12.5 mg tab , tendocare tab , thiamine 100mg tab , thyroxin 100 mcg tab , thyroxin 12.5mcg , thyroxine 25 mcg tab , thyroxine 50 mcg tab , thyroxine 75 mcg tab , ticagrelor 90mg tab brilinta , tofacitinib 5 mg tab , tolperisone sr 150 mg , tolterodine 2 mg tab , torsemide 10and spironolactone 50mg tab , torsemide 10 mg tab , torsemide 20 mg tab , tranexamic acid 500 mg and mefenamic 250 mg tab , triamcinolone 0.1per oral paste , trihexyphenidyl 2mg tab , trimetazidine mr 35 mg flavedon mr tab , trypsin and chymotrypsin 6 //bid details 2 / 113 1 100000 au enteric coated chymoral fort tab , ursodexycholic acid 300mg tab udiliv , vericiguat 2.5 mg tab , vildagliptin 50mg tab , vitamin e evion 200mg cap , voglibose 0.2mg tab , voglibose 0.3mg tab , xylometazoline 10 ml nasal drop , novopen needle all size , prucalapride 2 mg tab , tab relugolix 120 mg degarelix , tab prazosin 5 mg , insulin highly purified human neutral 40iu ml 10 ml inj regular , anastrazole 1 mg tab , acarbose 50 mg tab , antacid chewable digene tab , anti haemorrhoidal cream with beclomethasone dipropionate anovate oint , aspirin 150 mg tab , clopidogrel 75 mg tab , dapagliflozin 10 mg tab , dapaglifozin 5 mg tab , ed carboxy methyl cellulose 0.5 per bott of 5ml , etoricoxcib 90mg tab , inj glargine 100iuml 3ml pen , insulin aspart 30 per and insulin aspart protamine 70 per 100iuml i

CTN :42339003

27 Oct, 2025 NA

Udaipur - Rajasthan

Tender For supply of acarbose 50 mg tab , acotiamide 100mg tab , cilostazole 100 mg tab , cilnidipine 10 mg with telma 40 mg tab , acetylcysteine 300mg with pyridoxamine dihydrchloride 50mg tab , carbamazepine 200 mg tab , alcoholic hand sanitizer bott of 500 ml , glutaraldehyde solution 2.45per wv 5 ltr cidex activated gta solution , methylcobalamin 1500mcg with alpha lipoic acid 100mg with myo inositol 100mg with folic acid 1.5mg with chromium picolinate 200mcg with selenium 55mcg with benfotiamine 150mg , mebeverine 135 mg tab , loperamide 2mg tab , omega fatty acid with antioxidant cap , ondansetron 4mg tab , deflazacort 6mg tab , desloratadine 5mg tab , dexamethasone 0.5 mg tab , diosmin 450mg with hesperidin 50mg tab , dosulepin 25mg tab , fexofenadine 120mg with montelukast 10mg tab , hydrogen peroxide solution bottle of 500 ml , tab torsemide 5mg , tab vercigut 10mg , palonix tab 300 mg , inj erythropoetin 50 iu , disopyramide 100 mg cap , hif plus tab , tab oleptal 900mg , tab safinamide 50 mg , tab rivastigmine 3 mg , inj tirzepatide 5mg , tab sodium valproate 300mg , tab lobeglutazone 0.5mg , tab mirtazepine 7.5 mg , tab midodrine 2.5mg , tab carbamazepine 100mg , aspirin 75 mg and atorvastatin 10 mg tab , asthalin rotacap pack of 30 cap , oint hydroquinone 2per and tertinoin 0.025per and mometasone 0.1per , ketorolac 10 mg tab , novo pen needles , rifaximine 400 mg tab , zolpidem 10 mg tab , antispasmodic contaning mefenamic acid 250 mg and dicylcomine hcl 10 mg tab , inj insulin aspart 100 iuml , aceclofenac 100 mg and drotaverine 80 mg tab , glimepiride 2 mg and metformin 1000 mg tab , leviteracetam 250 mg tab , macvestin 500 mg tab , inj tirzepatide 2.5mg , primidone 25 mg tab , luliconazole ointment , inj methylcobalamine 500 mcg , paroxetine 12.5 mg and clonazepam 0.5 mg tab , trypsin and chymotrypsin and diclofenac tab , fusidic cream , liquid disodium hydrogen citrate 100 ml , syrup iron and vit b12 and folic acid 200ml , silver sulphadiazene oint , sodium bicarbonate 1000mg tab , sodium valproate 500mg tab , sumatriptan 50mg tab , syp ibugesic bott of 100 ml , tacrolimus 2mg tab , teneligliptin 20 with metformin 500mg tab , torsemide 100mg tab , torsemide 40mg tab , trifluoperazine 5mg with trihexyphenidyl 2mg tab , zolpidem 5mg tab , rotahaler for rotacaps , eye drop fluromethlolone , montelukast10 with bilastin 20mg tab //bid details 2 / 54

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Silicon Oxide Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector