Web Analytics Made Easy - StatCounter

Silicon Photomultiplier Tenders

Get complete information related to latest Silicon Photomultiplier Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Silicon Photomultiplier Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Silicon Photomultiplier Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Co-operative

CTN :40010086 Due date: 21 Apr, 202521 Apr, 2025 25.1 Thousand
Tender For supply of compact dry plate and plastic wares for pcr machine

CTN :39972665 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For quotation for rt-pcr plates (96 x 0.2 ml, 96 well) and rt-pcr plate sealer (for 96 well pcr plates, 130mm x 80 mm)

CTN :39794652 Due date: 29 Apr, 202529 Apr, 2025 NA
Tender For corrigendum : lab items - lab equipment s, binocular microscopes, portable water/soil kit, digital bod incubator, digital microscope with lcd screen and built in camera microscope , microscope inbuilt camera, digital haemoglobinometer (hbmeter), trinocular microscopes, autoclave, deep freezers 100 ltr, trinocular microscopes, water analyzer with colorimeter, d.o. meter, conductivity, tds, ph, salinity and temperature, autoclave, activity tds ph and temperature (water analyzer with colorimeter, d.o. meter, conductivity, tds, ph, salinity and temperature ), digital thermal cycler pcr, dissolved oxygen meter, cod analyzer with digestor, flame photometer, semi-automatic microtome, interactive uhd led board, distilling apparatus condenser, semi-automatic immunoassay analyser, electronic micro balance, viscocity meter bath, digital flame photometer with solution and compressor, digital potentiometer, ultrasonic interferometer, uv visible spectrophotometer, phase contrast microscope, hot air oven universal, water bath rectangular single walled, heating mantle, bunson burnars, buret stand, hot plate magnetic stirrer, double stage vacuum pump, digital flame photometer dual channel, columns for columns chromatography, polarimeter, digital abbe refractometer, ftir spectrometer this instrument is operated by a pc with user friendly software and a comprehensive manual, mixer / grinder, blotting paper, ganongs potometer, farmer s potometer, ganong light screen, ganongs respirometer, wilmots bubler appratus, arthron reagent, micropipet, acetone gas jar, farmerse photometer, stage micrometor, gas cylinder, 5 liter copper ghada, freeze /doubal door (230 lit), bm slide cabinate (capacity2000 slides size 15x18x3, cooling centrifuge, scepter cell counter, spectrophotometer, microtome rotary, bacterial colony count, tlc apparatus, osmotic pressure apparatus, seed germinattor, humidity & temperature control cabinet, plant growth, tissue culture rack, function generator, dual trace cro, study of elastic constant, susceptibility measurements, study o frank and hertz experiment, study of calcite prism, four probe methods, fourier analysis, oscilltors, study of ac oustical and optical modes, di electric constant, pn junction diode, e/m by thomsons method, study of solar cell, e/m by zeeman effect, hall effect, newtons ring app, rydbergs constant, gm counter, michelson interferometer, febry parot interferometer, rocks, minerals and fossils showcase almirah with glass, satellite imagery, gps wireless pocket receiver for survey or geologist, projector, fossils, fossils, micro scope ( petrological polarized microscope), 3d models ( structural geology), geological brunton compass with black lather case compass (black), digital camera, thin section of rocks slide, thin section of minerals slide, resistivity meter, slide film projector, india/asia/mp /world map physical and political, (tracing table with stand), (plumb bomb), prismatic compass, tripod stand, tape 50m, plain table tripod stand steel,sampatal wood set, simple aluminum alloy and fork, trough compas, engineering chain 100 feet, classical globe, theodo light complete set (tripath stand steel, reading scale, solar system automatic, french curve, natural map of the world in hindi 3d with frame, world political map in hindi 3d with frame, physical map of india in hindi 3d with frame, political map of india hindi 3d with frame, natural map of madhya pradesh in hindi 3d with frame, political map of madhya pradesh in hindi 3d with frame, sanitary vending machine, water cooler with ro

CTN :39576212 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of various glass ware and plastic ware items, at skims, soura, srinagar on one year rate contract basis. - item specifications note:- refer to nit for detailed item specifications, glass slides (75x25x1.25), conical glass flask (250ml), conical glass flask (500 ml), conical glass flask (1000 ml), conical glass flask (2000 ml), cylindrical flask 500ml, microtips (100 1000 l), microtips (0.5 - 10 l), micropipette tips (10 100 l), micropipette tips (20 - 200 l), glass funnels (large), glass funnels (small), glass funnels (medium), measuring cylinder (1000ml), measuring cylinder (500ml), measuring cylinder (250 ml), measuring cylinder (100ml), measuring cylinder (50ml), measuring cylinder (10ml), micropipette (variable) 100-1000 l, micropipette (variable) 1 10 l, micropipette (variable) 20 200 l, micropipette variable (0.2 2 l), micropipette variable (10 100 l), automatic pipette (10 100 l ), automatic pipette (100 l 1000 l), multichannel micropipette (100 1000 l) 8 channel, multichannel micropipette (2 l 20 l ) 8 channel, multichannel micropipette (30 l 300 l) 8 channel, multichannel micropipette (10 l 200 l ) 8 channel, microfuge tubes 1.8ml, microfuge tubes 1.5ml, tri-sodium citrate tubes (double sandwich) 1.8ml, blood collection tubes with edta k2 tubes with following specifications:1. capacity 2ml2. should have k2 coated in dried form.3. cap should have leak proof rubber cap with needle pierceable & plastic shield., blood collection tubes with clot activator, sodium floride tubes, urine processing tubes 10ml, sterile plastic urine containers 50ml, pasture pipettes with teets, cell counters, neubar chamber (improved), filter paper grade 1medium flow 11 m thick, dimensions: 460mm x 570mm, filter paper (410 r) ashless, digital ph meter, thermometers (for waterbath upto 100oc ), forceps (disecting) 6 inches, cover slips (22x22mm), cover slips (22x40mm), charged slides (22x40mm), cover slips (18x18mm), slide carrying trays aluminum 30x20cms with lock clips, slide drying rack (15x25 cms), glass beaker 1000 ml, glass beaker 500ml, glass beaker 250 ml, glass beaker 100 ml, glass beaker 50 ml, glass beaker 10ml, metal enamel tray 30x35 cms, staining racks (triangular slide with tapered top), staining dish (glass), slide staining rectangular bars stainless steel 36cm length, comet dropping bottles 60ml plastic material, tube holding rack with the capacity to hold 100 tubes, pcr tubes (0.2ml), polypropylene conical tubes 15ml (falcon tubes), polypropylene conical tubes 50ml (falcon tubes), plastic stand for 15ml conical tubes, plastic stand for 50 ml conical tubes, plastic droppers (5ml), terrasaki plates for hla typing, aluminum chambers for patch testing, tip boxes for 10 l tips, tip boxes for 100 l tips, tips boxes for 1000 l tips, racks for holding 0.2ml pcr tubes, pipette stand for micropipettes, culture bottles flat type (sterile 100ml), discard jar 5 ltr., reagent bottle with screw cap autoclavable (1000 ml), reagent bottle with screw cap autoclavable (500 ml), reagent bottle with screw cap autoclavable (250 ml), reagent bottle with screw cap autoclavable (200ml), reagent bottle with screw cap autoclavable (100 ml), dilution bottles 500ml, gastric lavage bottles 200ml plastic, evidence bag 12 x 16 , animal cell culture media bottle 250ml, epindrof tubes (micro tubes) 1ml, gluco meter pen, blood glucose monitoring strips (successful bidder will have to provide one gluco meter free of cost with every 1000 strips). , multi sticks for urine examination, blood lancets, ph tablet 4.0, ph tablet 7.0, ketone meters, ketone strips, biochemistry disposable cuvettes, assorted racks, autoclavable mesh baskets (medium size), cryovials (1.8ml) screw cap sterile, multipurpose stands (plastic), petri dishes 90mm plastic (autoclavable), storage vials screw caped (2ml), two quadrant petri plates 90mm autoclavable, microtiter plate (round bottom), sterile swabs (plastic), swab bowls, culture vials glass 30ml, culture vials glass 15ml, gl

State Government

CTN :39699361 Due date: 15 Apr, 202515 Apr, 2025 NA
Tender For corrigendum : supply of plastiware item - 0.2 ml pcr tube with flat cap, sterile,dnase & rnase free, ultra-thin walls, 0.5 ml microcertrifuge tube,dnase & rnase free, graduated with froasted labelling surface, clear, sterile, 1.5ml microcertrifuge tube,dnase & rnase free, graduated with froasted labelling surface, clear, sterile, 2.0ml microcertrifuge tube,dnase & rnase free, graduated with froasted labelling surface, clear, sterile, 96 well plate semi skirted,sterile,dnase & rnase free, compatible for 3500xl/seqstudio genetic analyzer, 96 well plate semi skirted, sterile, dnase & rnase free, for quantstudio 5 real time pcr system, 15 ml centrifuge tube, dnase & rnase free, graduated with labelling surface, clear, sterile, 50 ml centrifuge tube, dnase & rnase free, graduated with labelling surface, clear, sterile, cryo box for 1.5 ml, more 80 places, tough tag, 1000 spot per roll, filtered micro tip up to 10xl/ 20 l, bulk packed, low retention, sterile, universal tip, dnase & rnase free, filtered micro tip up to 10xl/ 20 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 10 l, bulk packed, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 10 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 20 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 50 l, racked, l w retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 100 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 200 l racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 1000 l racked, low retention, sterile, universal tip, dnase & rnase free,, kimwipes, pack size-280 wipes/pack, disposable latex examination glovess,pack size medium-100pcs,thickness 4 mils or better, disposable latex examination gloves, pack size large-100 pcs, thickness 4 mils or better, nitrile examination gloves (medium size), pack size-100 pcs, thickness 4 mils or better, nitrile examination gloves (small size), pack size-100 pcs, thickness 4 mils or better, nitrile examination gloves (large size), pack size-100 pcs, thickness 4 mils or better, optical adhesive film for realtime-pcr 96 well plates, free of dnase&rnase and human dna, seal integrity from 80 to 110 c, pack size-100 pcs, parafilm dispenser with safety razor/cutter, parafilm m 2-inch x250 ft, 0.2ml pcr tube 96 place rack with cover, micro pipette stand 7 places or more, rack for microcentrifuge tube (1.5/2 ml), 48 places, rack for microcentrifuge tube (1.5ml) 24 places, reversable rack with cover, 96 place, strile disposible petridish 90-100 mm diameter, strile disposible petridish 150 mm diameter, 50ml tube stand (12 places), zero degree mini cooler 12 places, 1.5ml capacity, dna concentration device 0.5ml- volume capacity 0.5ml cutoff 30kda molecular weight high recovery ultracel regenerated cellulose membrane vertical v-shape membrane, device compatible for phenol-chloroform dna extraction process., dna concentration device 4 ml high recovery ultracel regenerated cellulose membrane volume capacity 4 ml cutoff 30kda molecular weight vertical v-shape membrane device compatible for phenol-chloroform dna extraction process. maximum relative centrifugal force (with fixed angle rotor) 14000xg, disposible mask made up of non-woven fabric, triple layered, induvial packed, sterile, disposible head cover, disposable pp non-woven shoe covers, disposible apron, medium size, disposible apron, small size, surgical scissors, stainless steel, rust free, 6" size, surgical scissors, stainless steel, rust free, 8" size, surgical scissors, stainless steel, rust free, 10" size, scalpel holder no. 4, scalpel blade no. 20 ,100 pcs per pack, scalpel blade no. 22,100 pcs per pack, spatuala, stainless steel, rust

CTN :39889570 Due date: 15 Apr, 202515 Apr, 2025 30.00 Lacs
Tender For supply of lab reagents and consumables - semi-automactic bio-chemistry analyzer, albumin (5x50ml), alkline phosphtase 4x24 + 4x6ml), bilirubin kit (4x60ml), cholestrol kit (5x30ml), creatinine kit (4x60m)l, ggt (5x6.5ml), glucose kit (5x60ml), hdl kit (4x30ml + 4x10ml), high control for semi auto (1x5ml), normal control for semi auto (1x5ml), sgot kit (4x24ml + 4x6ml), sgpt kit (4x24ml + 4x6ml), total protein (5x50ml), triglycerides kit (4x24ml + 4x6ml), urea kit (4x24ml + 4x6ml), uric acid kit (4x24ml + 4x6ml), wash kit (4x50ml), general lab chemicals and consumables, absolute alcohol 70% (500 ml), almunium slide tray, anti ab, anti d ( igg+ igm), anti human sera/ coombs sera, anti sera abo rh/ blood group test kit (10ml each, total 30ml), anti-d igg 10 ml, anti-d igm 10 ml, aso 50 test titer rapid method, band aid, beaker 1000ml, beaker 100ml, beaker 250ml, beaker 500ml, blood grouping plate, blotting sheet, blue tips, bovine albumin, capillary tubes, card for haemo spot, centrifuge tube stand 15 ml(10*2), centrifuge tube stand 50 ml(15*2), conical flask 500 ml, coplin jars, copper sulphate powder 500gm, covid elisa anigen kit (icmr approved), crp 50 test kit (qualitative), cryo box with lid, cryo vials 2 ml, culture swab stick, diamond marking pencils, disposable alcohol swab, disposable esr pipette, disposable esr tube (westergen method), distilled dionized water 5 ltr, distilled double dionized water 5 ltr, distilled triple dionized water 5 ltr, double blood bag 300 ml, dpx mount, durham tube, edta vial (non vacuum), edta vial (vacuum), eppen drop vial ( mct ), esr black vial (non vacuum), esr black vial (vacuum), esr stand, ethanol absolute, falcon tube, filter paper, filter tip 10 micro litre (1*960), filter tip 100 micro litre (1*960), filter tip 20 micro litre (1*960), filter tip 200 micro litre (1*960), filter tip 5 micro litre (1*960), floride vial (non vacuum), floride vial (vacuum), fouchet reagent, giemsa stain 125 ml, glacial acetic acid, glass bottel round 1000ml, glass bottel round 500ml, glass cover slip 22 mm, glass pipett 10ml, glass pipett 2ml, glass pipett 5ml, glass slide, h & e stain (haematoxillin stain), h.i.v elisa 4th generation (96 test), hand sanitizer 5 ltr (ip base), hbsag card, hbsag elisa 4th generation (96 test), hcv elisa 4th generation (96 test), hcv rapid card, hiv rapid card, hydro chloric acid 500 ml, ice gel pack, j.s.b 1 stain, j.s.b 2 stain, kalazar test rapid card, lancet (auto destroyable/safety lancet), lancet (twisted round), leucoreduction filter, lieshmen powder 25 gm, lugal iodine 125 ml, malaria antigen card, manual rna extraction kit 50 test (icmr approved), mathenol 2.5 ltrs, mct vials 1.5ml, mct vials 2.0ml, measuring cylinder 1000ml, measuring cylinder 100ml, measuring cylinder 20ml, measuring cylinder 500ml, microscope cover glass 22 x 40 mm, micropipette single channel fixed volume fully autoclavable (all size variants), micropipette single channel variable volume fully autoclavable (all size variants), micropipette 8 channel variable volume fully autoclavable (all size variants), micropipette 12 channel variable volume fully autoclavable (all size variants), multistix, n/10 hcl 500ml, naoh sodium hydroxide, og 6, oil immersion 25ml, o-toluidine (500ml), parafilm tape, pastuer pipette, ph paper 5.0 to 7.5, plain vial (non vacuum), plain vial (vacuum), potassium permagnate, ppe kit (citra & drda approved), pregnancy cards/ upt cards, qiaamp dna blood mini kit (250 test), qiaamp viral rna blood mini kit (250 test), quadraple blood bags 450ml, ra factor 50 test kits, rapid antigen detection card test for bacterial meningitis, rapid pap stain kit, rapid test card for cephalosporin, rapid test kit igg, igm, ns1 for dengue, reversible rack mct, rt-pcr flu kit (192 test), rt-pcr hbv quantative kit (192 test), rt-pcr hcv quantative kit (192 test), rtpcr kits 96 test for covid-19 (icmr approved), rubber teat for pipette, salt iodine testing kit, sample cup with label (3 s

State Government

CTN :39841859 Due date: 17 Apr, 202517 Apr, 2025 NA
Tender For supply of reagents and consumables for sanger sequencer model abi 3500xl - bigdye terminator v3.1 sequencing kit, 100 reaction, bigdye xterminator purification kit.100 preps, bigdye terminator v1.1,v3.15x sequencing buffer ,1ml, high capacity cdna reverse transcripastion kit with rnase inhibitor ,1000rxn, genescane 500 liz standrad 800 rxn, exosap-it clean up kit, 100 rxn, hidi formamide,5mlx4 pack, cathode buffer container, anode buffer container, multicapilliary ds33,8 runs, pop7,960 rxn, conditioning reagents, platinum superfi pcr master mix ,100 reaction, clonejet pcr kit, ro rxn, competent cells 10x100 ul, fix 7 perm medium a,100 ml, fix 7 perm medium b,100 ml, fluorescent primers,10000p moles, pop7,96 rxn, generuler dna ladder lo0bp s0ug fermantas, 6xloading dye solution r0611 mbi fermenta, microamp clear adhesive film, 100 pc, septa 96 well plate, microamp optical 96 wells reaction plate barcoded, superscript vilo cdna synthesis kit

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
 Loading, Please wait...

Connect us via What's Up