Latest sodium bi carbonate Tenders | Government sodium bi carbonate Tenders

corporations/Associations/Others

CTN :39889131

09 Apr, 2025 4.71 Lacs

Delhi - Delhi

Tender For procurement of reagents and chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi - supply of reagents & chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi.ammonium chloride (500 gm), tri-ammonium citrate (500 gm), ammonium ferrous sulphate (500 gm), ammonium buffer solution (500 gm), boric acid ar (500 gm), bromocresol green soln. (125 ml), calcium chloride fused (500 gm), carbon tetrachioride(500 gm), di-potassium hydrogen ortho phosphate (500 gm), dithizone (5 gm), ethyl acetate (500 ml), ferric chloride (500 gm), ferrous sulphate crystalline (500 gm), haxane ar (500 ml), hydrochloric acid (500 ml), lead nitrate (500 gm), macconkey broth (500 gm), silver nitrate n/50 solution (500 ml), mercuric oxide(red/yellow) (100 gm), mercuric sulphate (250 gm), methyl red indicator soln.(125 ml), nitric acid (500 ml), methyl blue indicator alkaline (125 ml), paraffin wax 58-60 & 60-62 (500 gm), petroleum ether(bp 40-60c) (500 ml), phenol crystal(500 gm), phenolpthalen indicator solution (125 ml), 1.10 phenanthroline monohydrate (ferroin indicator) (5 gm), potassium dichromate ar(500 gm), potassium lodate(250 gm), potassium lodide(250 gm), potassium nitrate anhydrous ar(500 gm), potassium permanganate(500 gm), potassium sulphate (500 gm), silver sulphate(25 gm), sod.azide(100 gm), sodium chloride(500 gm), sodium meta bisulphite(500 gm), sodium nitrate(100 gm), sod.sulphite(500 gm), sod.thiosulphate(500 gm), sodium hydrogen phosphate(500 gm), stannous chloride(250 gm), sulphamic acid(500 gm), thymol blue indicator soln. (pack of 125 ml), edta n/50solution (500 ml)

CTN :39870162

15 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges/ hospitals in telangana state under rate contract for a period of 2 years - ethyl acetoacetate , sodium hypobromite , horse gram powder , sodium carbonate anhydrous lr , urea extra pure 99% , uric acid powder ar , total protein kit , s. albumin , albumin , dextrose anhydrous lr , bilirubin powder , glucose god.pod , beakers glass (100ml) , measuring cylinders (50ml) , measuring cylinders (500ml) , glass pipette (10ml) , glass pipette (5ml) , glass funnels , plastic funnels , glass reagent bottle (500ml, wide mouth) , glass reagent bottle (250ml, wide mouth) , glass reagent bottle (500ml, narrow mouth) , glass reagent bottle (250ml, narrow mouth) , test tube cleaning brushes , disposable tips (200ul) , urine jars , suction bulbs (big) , suction bulbs (small) , autopipettes 1000ul (fixed) , autopipettes 10-100ul , autopipettes 5-20ul , autopipettes 100-1000ul , spatulas (plastic) , spatulas (steel) , creatinine anhydrous, hi-ar , urease powder , beakers glass (2l) , bcg , na. k.taratarate , sodium chloride , benzoic acid , sodium nitrite , bilirubin standard , methanol-5lts , nh3 , hydrogen peroxide 3 % , liquid ammonia , orthophosphoric acid , sodium thiosulphate , pottasium ferrocyanide , butanol , barbutric acid , agarose powder , amido black , tris buffer , nin hydrine , diethylbarbitone , diacetyl monoxime , all ammino acid kit for chromotography , cellulose acetate paper , light green strain a , light green strain b , boric acid , lissamine green , amminum molybdate , tca , sodium sulphate , sulphur powder , thiosemicarbazide , uric acid powder , sodium hypobromide , potassium dihydrogen phosphate , sulphuric acid-2.5 lts , sulphosalicilic acid , sodium hydroxide pellets , picric acid-500gms , creatinine standard , potassium dichromate , carbinol , disodium hydrogen phosphate , glucose standard , urea standard , starch , sublimed iodine crystals , sulphanilic acid , hydrochloric acid , edta , ferric chloride , potassiumoxalate , acetone ar , dextrose (d.glucose) , sodium nitroprusside , ammonia sulphate , bencdicts reagent , calcium chloride (fused) , ethyl alcohol , iodine , mercuric chloride , pottasium iodide , silver nitrate , sodium bicarbonate , lactose , sucrose , maltose , orthotoulidene reageant , buffer tablets 7/9.2/4 , phenol , sulphuric acid-500 ml , bacl2 , na2co3 , methyl orange , phenopthaline , caco3 , mgso4 , nh4cl2 , barium chloride powder , benedict uric acid reagent , benedicts reagent , dry creatinine powder , dry d-glucose powder , dry urea powder , ehrlich reagent , filter paper regular , fouchets reagent , litmus paper blue , magnesium sulphate powder , ph paper with chart , phenol red indicator , phenopthalein indicator , sodium hydroxide , sodium hypobromite ampule , sodium nitropruside , sulphosalicilic acid , sulphur powder , craft water testing chemical kit , buffer solutions (ph 7) for ph meter , glucose kit-liquid form , urea kit -liquid form , creatinine kit-liquid form , total cholesterol kit-liquid form , hdl-cholesterol kit-liquid form , ldl-cholesterol kit-liquid form , triglycerides kit-liquid form , phosphorous kit-liquid form , calcium kit - ocpc-liquid form , uric acid kit-liquid form , bilirubin direct kit-liquid form , bilirubin total kit-liquid form , total protein kit-liquid form , albumin kit-liquid form , sgpt-r kit-liquid form , sgot-r kit -liquid form , alkaline phosphate kit-liquid form , amylase kit -liquid form , erba wash-liquid form , erba norm-liquid form , erba path-liquid form , direct- hdl-liquid form , direct-ldl-liquid form , ggt kit-liquid form , ggt control , ggt calibrator , iron kit , iron control , iron calibrator , tibc kit , tibc control , tibc calibrator , microalbumin kit , microalbumin control , microalbumin calibrator , ec5 plusv2 am kit , carbolic acid , for pediatric usevacum balood collectin tubes (red color) , ehrlichs reagent , bilirubin total direct kit liquid form

CTN :39870164

19 Apr, 2025 NA

Multi City - Telangana

Tender For procurement and supply of reagents and consumables to the government colleges hospitals in telangana state under rate contract for a period of 2 years - copper sulphate , dpx , eosin , glycerol , hydrochloric acid , hydrogen peroxide 500ml , paraffin wax (58aa to 60aa c) , phenol5lts , sodium borate , sodium citrate , spirit , 1% phospho moiybdic acid , dilute hcl , fehlings a , fehlings b , ferric chloride 10% , mayers reagent solution , molish reagent , picric acid500ml , povidene iodina , waghers reagent , normal saline (ns) , pilots solution , reeseckler diluting fluid , ringer lactate (rl) , brilliant cresyl blue , cedal wood oil , hypochlorite , leishman stain , rbc diluting fluid , 1% calcium chloride , 1% potassium chloride , wbc diluting fluid , xylene2.5 ltr , xylene25 ltr , xylene 500 ml , formalin5lts , distilled water , iodine testing chemical kits , jsb stain solution 1 , microscope oil , n 10 hcl , ortho toulidin reagent , potassium iodide powder , sodium thiosulphate , soil testing chemical kit , starch powder , 30% hydrogen peroxide500ml , 50% slycerol sodium , ethlene floride , formalin , hcl , liquid parafin , nacl , naf , potassium floride , rutherford spirit , sodium azide , sodium hypochlorite , orthovision blood group analyser iqc , anti a , anti b , anti d igm , anti ab , anti ahg , anti a1 lectin , anti h lectin , anti d igg igm , bovine albumin , hydrogen peroxide 1trs , rbc pipettes , wbc pipettes , hb pipette , pen needles , ishiharas charts , jaeger charts , lens cleaning solution , watch glasses , petri dish glass , petri dish plastics

Corporations And Associations And Others

CTN :39006246

15 Apr, 2025 NA

Gidderbaha - Punjab

Tender For corrigendum : supply of sodium bi-carbonate at gidderbaha plant

State Government

CTN :39391119

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For corrigendum : online tender for the rate contract and supply of pharmaceuticals to various hospitals of government of madhya pradesh for a period of 18 months - drugs, acyclovir 3%(ointment),ointment, alfacalcidol 0.25mcg, calcium 200mg (0.25mcg+200mg),capsule, alfuzosin (10mg),tablet /capsule, amantadine (100mg),tablet, amisulpride (50 mg),tablet, anti d immunoglobulin for iv/im use (monoclonal) (150mcg (1ml vial)),injection, anti thymocyte globulin (250mg/5ml),injection, atorvastatin + asprin (10mg + 75mg),tablet or capsule, bisoprolol (5 mg),tablet, busulphan(60mg/10ml),injection, canagliflozin (100 mg),tablet, carbamazepine(100 mg / 5ml 100ml bottle),syrup, chlorthalidone (12.5mg ),tablet, clobetasole propionet 0.05% + salicylic acid 3% (15gm tube),ointment, cyclosporine (100mg),capsule, cyclosporine(100mg/ ml),solution, cyclosporine(50mg),capsule, dacarbazine 200mg (10mg/ml),injection, diclofenac+paracetamol+chlorzoxazone (50mg + 325mg + 250mg),tablet, diloxanide furoate (tablet 500 mg),tablet, etophylline + theophylline sr tablet 231mg + 69mg,tablet, fat emulsion 20% (250ml),injection, ferric carboxymaltose 50mg/ml(20ml vial),injection, fluvoxamine (100mg),tablet, fluvoxamine (50mg),tablet, formoterol 6mcg + budesonide 400mcg (30 cap x 6 pack with 1 dispensing device),rotacaps, gatifloxacin (0.3% ),eye drop, glargine 100 iu /ml, 3ml cartridge inj. (firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost)(100 iu /ml),cartridges, glimepride 2mg + metformin 1000mg (tab),tablet, hepatitis b immunoglobulin (100 iu/vial),vial, human insulin regular/soluble (100iu/ml (10ml vial)),injection, hydrocortisone sodium succinate inj. 200mg vial,injection, hydroquinone 2% + mometasone 0.1% + tretinoin0.025% (5 gm tube),cream, hydroxy propyl methyl cellulose injection 2% (3ml prefilled syringe),syrings, ipratropium bromide inhaler 20mcg per puff (200 metered dose container),inhaler, irinotecan hydrochloride (100mg),injection, labetalol 5mg/ml (4ml ampl),injection, lactulose (10gm/15ml (100 ml bottle)),solution, lamotrigine dt tab (100mg),tablet, levetiracetam 100mg/ml syrup/ solution (100ml bottle),syrup, lorazepam (2 mg),tablet, magnesium sulphate injection (50 % w/v 10ml amp),injection, medroxyprogesterone acetate (injection 150 mg 1ml/vial),injection, moxifloxacin ( 400mg),tablet, nepafenac(1mg/ml),eye drop, nicotine (nrt) (2 mg chewing gum ),gum, nicotine (nrt) (4 mg chewing gum ),gum, pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg(tab)(tablet (with additional content acceptable)),tablet, phenobarbitone (200 mg/ml),injection, potassium chloride 150mg/ml injection, 10ml ampoule (10ml ampoule),injection, pregabalin (75mg),capsule, rabeprazole + levosulpiride (20mg +75mg),tablet or capsule, rifaximin (400mg),tablet, sitagliptin (100mg),tablet, sitagliptin + metformin (50mg + 500mg),tablet, sodium hyaluronate (intraocular) (1% /ml),injection, sorafenib (200mg),tablet, tenecteplase (40mg),injection, tenecteplase 20mg (20mg),injection, teneligliptin (20mg),tablet, thyroxine sodium (75 mcg),tablet, tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg (pack of 180 to 200mdi),inhaler, tiotropium 9mcg 180 doses inhaler (180 or more doses acceptable),inhaler, tricholine citrate + sorbitol (550mg + 7.15 g/10ml ),syrup, vinblastine (10mg),injection, vitamin d3 (800iu/ml),drop, voglibose (0.2 mg),tablet, water for injection 5ml amp

CTN :39873483

08 Apr, 2025 NA

Netanar - Chhattisgarh

Tender For supply of ferric chloride is: 711 min. 98% by weight , sodium metabisulphite is: 248 min. 60% purity as so2 by mass , sodium hypochlorite is: 11673: 1992 grade: 2 conc 10%

Central Government/Public Sector

CTN :39873539

19 Apr, 2025 NA

Gautam Budnagar - Uttar Pradesh

Tender For supply of supply of 15000 mt sodium bi carbonate through bulkers for dsi system at ntpc dadri

CTN :39856104

07 Apr, 2025 2.50 Lacs

Multi City - Karnataka

Tender For purchasing of chemicals consumables to chemistry research center gec ramanagara-, , zinc nitrate hexahydrate [zn(no3)2. 6h2o], , cerium nitrate hexahydrate [ce(no3)3. 6h2o], , chromium nitrate nonahydrate [cr(no3)3 .9h2o], , cobalt nitrate hexahydrate [co(no3)2.6h2o], , copper nitrate hexahydrate [cu(no3)2.6h2o], , silver nitrate [agno3], , titanium nitrate [ti(no3)4], , magnesium nitrate hexahydrate [mg(no3)26h2o], , nickle nitrate hexahydrate [ni(no3)26h2o], , cadmium nitrate [cd(no3)2], , chromium (iii) nitrate nonahydrate [cr(no3)3.9h2o], , sodium nitrate (nano3), , sodium nitrite (nano2), , strontium nitrate [sr(no3)2], , bismuth nitrate [bi(no3)3)], , iron nitrate (ferric nitrate) [fe(no3)3.(h2o)n], , zirconium nitrate [zr(no3)4], , gadalonium nitrate [gd(no3)3], , tin (iv) chloride pentahydrate [sncl45h2o], , titanium isopropoxide [ti{och(ch3)2}4.], , niobium (v) nitrate [nb(no3)5], , ammonium nitrate (nh4no3), , zinc sulphate (znso4), , copper sulphate (cuso4), , magnesium sulphate heptahydrate (mgso4.7h2o), , nickle sulphate hexahydrate (niso46h2o), , chromium sulphate hexahydrate [cr2(so4)36h2o], , cerium sulphate hexahydrate [ce(so4)26h2o], , manganese acetate tetrahydrate [mn(ch3coo)24h2o], , zinc acetate heptahydrate [zn(ch3coo)27h2o], , zinc acetate hexahydrate [zn(ch3coo)26h2o], , chromium acetate [cr(ch3coo)2], , tetraethyl orthosilicate (teos) [si(oc2h5)4], , sodium silicate (na2sio3), , sodium metasilicate pentahydrate [na2sio35h2o], , sodium metavanadate [navo3], , vanadyl sulphate hydrate [voso4.xh2o], , chromium sulphate [cr2(so4)3], , ammonium, , tungstate, , pentahydrate, , [(nh4)10(h2w 12042)5h2o], , ammonium vanadate (nh4vo3), , sodium tungstate dihydrate (na2wo4.2h2o), , tungsten hexacarbonyl [w(co)6], , tungsten hexachloride (wcl6), , sodium bicarbonate (nahco3), , sodium hydroxide (naoh), , sodium chloride (nacl), , sodium sulphate (na2so4), , sodium lauryl sulphate (sls), , sodium dodecyl sulphate (sds), , cetyl trimethyl ammonium bromide (ctab), , boric acid (h3bo3), , ammonium hydroxide (nh4oh), , ammonium chloride (nh4cl), , hydrochloric acid (hcl), , sulphuric acid (h2so4), , ethylenediaminetetraacetic acid (edta) [c10h16n2o8], , potassium hydroxide (koh), , ethanol (c2h5oh), , urea [nh2conh2], , glycine [c2h3no2], , 2, , 4, , citric acid [c6h8o7], , acetone [ch3coch3], , nickel mesh (to prepare working electrode), , nickle foam, , 6, , nafion [c7hf13o5s c2f4], , 7, , whatmann filter paper (no. 41), , tissue paper (laboratory grade)

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Sodium Bi Carbonate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

corporations/Associations/Others

Corporations And Associations And Others

State Government

Central Government/Public Sector

Central Government/Public Sector