Web Analytics Made Easy - StatCounter

Sodium Hydroxide Flake Tenders

Get complete information related to latest Sodium Hydroxide Flake Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Sodium Hydroxide Flake Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Sodium Hydroxide Flake Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

CTN :40031724 Due date: 07 May, 202507 May, 2025 NA
Tender For supply of sodium hydroxide flakes qty: 80 mt[ for ttp plant, cpcl manali chennai,sodium hydroxide flakes qty: 80 mt[ for ttp plant, cpcl manali chennai,sodium hydroxide flakes qty: 50 mt[ for desalination plant, katupalli chennai],sodium hydroxide flakes qty: 50 mt[ for desalination plant, katupalli chennai]

CTN :39920812 Due date: 25 Apr, 202525 Apr, 2025 NA
Tender For supply of phenol red , ph strip , turbidity transparency tube , hexamethylenetetramine 99 extra pure , hydrazine sulphate 99 ar acs , potassium chloride 99 extra pure , ethylenediamine tetraacetic acid disodium salt 99 ar acs , eriochrome black t aracs , ammonia solution 30 ar acs , ammonium acetate 98 molecular biology , silver nitrate 99 9 ar acs , potassium chromate 99 5 ar , griess reagent kit , n 1 naphthyl ethylene diamine dihydrochloride 98 ar acs , sulphanilic acid 99 ar acs , orthophosphoric acid 85 for hplc , sodium nitrite 98 ar acs , cadmium metal granular 99 9 ar , zinc metal granular 99 5 extra pure , potassium nitrite crystals 96 ar acs , o tolidine 98 ar , alizarine ar , sodium fluoride 99 ar , zirconium oxychloride octahydrate 99 ar , spadns ar , sodium arsenite 98 ar , hydrochloric acid 37 acipur , 1 10 phenanthroline hydrochloride monohydrate 99.5 ar , hydroxylamine hydrochloride 99 ar acs , acetic acid glacial 99 7 ar , ammonium acetate 99 for hplc , sodium acetate anhydrous 99 ar acs , ammonium ferrous sulphate hexahydrate 99 ar acs , arsenic trioxide 99 ar , mercuric bromide 99 ar acs , zinc dust 95 extra pure , sodium hydroxide pellets 98 ar , mercuric bromide strips , cupric chloride dihydrate 99 ar acs , dithizone 98 ar , chloroform 99 8 ar , sodium sulphite anhydrous 98 ar acs , lead acetate trihydrate 99 ar acs , chloramine t trihydrate 99 ar , pyridine 99 5 ar , barbituric acid 99 ar , potassium cyanide 97 ar , picric acid 99 8 ar , sodium carbonate anhydrous 99 5 extra , sodium dihydrogen orthophosphate dihydrate 99 ar , water sample analysis , macconkey broth double strength , macconkey agar , durhams tube

CTN :39530511 Due date: 15 Apr, 202515 Apr, 2025 NA
Tender For corrigendum : supply of various chemicals and fine chemicals, at skims, soura, srinagar on one year rate contract basis. - item specifications, 2-mercaptoethanol, absolute alcohol 99%, acetic acid, acetic acid glacial, acetone, acid fuchsin, acrylamide, alpha naphthol, alpha naphthylamine, ammonium acetate, ammonium chloride, ammonium persulphate, amyl alcohol, basic fuchsin, bis-acrylamide, bismark brown (powder), boric acid, bromophenol blue, calcium chloride, calcofluor white, carbol fuchsin (zn, strong), chloroform, conc. hydrochloric acid (hcl), conductive electrode paste/eeg paste, copper sulphate, crystal violet, diethyl pyrocarbonate (depc), dimethyl formamide, dimethyl sulfoxide (dmso), dimethyl-p-phenylene diamine dihydrogen chloride, dipotassium hydrogen phosphate, disodium edta, disodium hydrogen phosphate, dpc, dpx, edta dipotassium salt, eosin liquid, eosin powder, eosin y, ethanol 99%, ethedium bromide (etbr), ethyl alcohol, formaldehyde 37%, formic acid 85%, fungizone, giemsa stain, glycerol glycerin 98%, haematoxylin harris, hematoxylin (liquid), hematoxylin (powder), hydrochloric acid (98%), hydrogen peroxide (30%), hypochlorite solution (4%), iodine, isoamyl alcohol, isopropyl alcohol 99%, l pyrrolidonyl-b-naphthylamide, laboratory detergent, leishman s stain, liquid ammonia, lithium powder, magnesium chloride, magnesium citrate, magnesium sulphate, may grunwald stain (powder), mercuric oxide powder, methanol 99%, methyl red (powdered), methylated spirit, methylene blue (powdered), medical grade soda lime with following specifications: 1. should have high absorption capacity for carbon dioxide (more than 100 ltr/kg)2. should have low dust level.3. granule size 2.5-5.0 mm4. indicator pink to white., n acetyl l cysteine, n,n, dimethyl formamide, nigrosin, nitric acid 72%, para dimethyl amino benzaldehyde, para-dimethyl amino cinnamaldehyde, parafin oil (liquid), periodic acid, phenol, phenol (tris saturated), phosphate buffer saline capsules/tablets, potassium acetate, potassium bicarbonate, potassium chloride, potassium dichromate, potassium dihydrogen orthophosphllate, potassium dihydrogen phosphate na2hpo4, potassium ferro cyanide k4fe(cn), potassium hydroxide, potassium iodide, potassium permanganate, silver nitrate, skin preparation gel, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium deoxycholate, sodium dihydrogen orthophosphate, sodium dihydrogen phosphate, sodium dodecyl sulphate (sds), sodium hippurate, sodium hydroxide, sodium hypochlorite, sodium taurocholate, sucrose, sulfanilic acid, sulphuric acid, tetramethyl-p-phenylene diamine dihydrogen chloride, toluidine blue (powder), tris, tris hcl, urea (nh3conh2), xylene 98%

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39835334 Due date: 16 Apr, 202516 Apr, 2025 6.00 Lacs
Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer
 Loading, Please wait...

Connect us via What's Up