Latest sodium hypo chloride solution Tenders | Government sodium hypo chloride solution Tenders

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39836121

16 Apr, 2025 NA

Kollam - Kerala

Tender For supply of sodium hypochlorite solution (v2) as per is 11673 (part 1) (q2)

CTN :39827820

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials in hulical town panchayat - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39827891

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials - public health materials, bleaching powder(p/h), bleaching powder(w/s), white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, lyzol floor cleaner disinfectant, sodium hypochlorite solution, mask, emi stock solution, soap oil, (harvicide), fogging gas cylinder, rubber glouse, cotton gloves, rain coat(male & female), life jacket with reflector, helmet, gum boot, plastic basin, 50 lit syntax backet, white lime powder, , ( ), ( ), ( ), , ( ), ( ), ( ), ( ), , , , , 80 lit syntax bucket, 4 pin hook with pipe handle (sumal), 4 pin hook with pipe handle (big), grass knife, hand sanitizer, sprayers(12 liters capacity), sprayers(16 liters capacity), plastic koodai(sumall), syntex bucket (50 lit), syntex bucket (70 lit), plastic koodai(big), 24 mm crowbar, 25mm crowbar, shawel, water testing kit

CTN :39828261

29 Apr, 2025 20.00 Lacs

Chhatarpur - Madhya Pradesh

Tender For supplying of various types of chemical and powder material for financial year 2025-26 under municipal council chhatarpur - esolic powder, phenolic powder, carbolic powder, dusting powder, deo dezing powder, coro dusting powder, disinfect powder, malaria oil, antilarva oil, white floor cleaner, black floor cleaner, deo dezing lad, toilet cleaner, fogging oil, sodium hypochlorite solution, bleaching powder, glass cleaner, floor cleaner, napthalene bals, handwash, ferric alum grade - i, white phenyl, black phenyl

CTN :39793885

28 Mar, 2025 NA

Nilgiris - Tamil Nadu

Tender For supply of public health materials at naduvattam town panchayat - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39794075

28 Mar, 2025 50.00 Lacs

Nilgiris - Tamil Nadu

Tender For ovtp supply of public health materials - public health materials, bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39809138

28 Mar, 2025 10.00 Lacs

Nilgiris - Tamil Nadu

Tender For supply of public health materials in sholur first grade town panchayat 2025-2026 - bleaching powder, white phenoil, black phenoil, lime powder, ferric alum, cleaning acid, rubber glouse, lyzol, sodium hypochlorite solution, mask, emi solution, aero star cum cylinder, malaythiyan, pythrium, baytex, abet, syntex bucket (50 lit), syntex bucket (70 lit), gum foot, 1.4 tata manvetty, 24 mm crowbar, 25mm crowbar, shawel, bamboo basket (big), bamboo basket (small), drainage manvetty, 4 pin frang, grass knife, reflection coat, steel frang (small), steel frang (big), plastic basin, broomstick, 5" broomstick, water testing kit

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

Sodium Hypo Chloride Solution Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

corporations/Associations/Others