Latest sodium oxalate Tenders | Government sodium oxalate Tenders

CTN :39873328

18 Apr, 2025 NA

Ambala - Haryana

Tender For supply of medicine - inj bleomycin sulphate 15 units vial , hydrocortisone acetate cream 1 percent ww tube of 15 gm , cap minocycline er 65 mg , tab minoxidil 2 point 5 mg , clobetasol propionate 0 point 05 percent w w plus buffered lactic acid 12 percent w w 30 gm gel , zinc oxide and benzalkonium chloride cream tube of 30 gram , 0 point 1 percent triamcinolone acetonide bucccal parts 7 point 5 gm tube , calcium pantothenate tablet 200 mg , lot padophyllin resin 20 percent bott of 10ml , tab acetretin 10 mg , clindamycin 1 percent w v benzoyl peroxide 5 percent w w gel 20gm , cyclophosphamide 500 mg inj , lot lactic acid 17 percent plus salicylic acid 17 percent bott of 15ml , lot ciclopirox 1 percent w v zinc pyrithidone 1 percent 100ml , cyclosporine eye drops 0 point 05 percent bott of 3 ml , ketorolac tromethamine 0 point 4 percent eye drops 5 ml , brimonidine tartrate 0 point 2 percent eye drops 5 ml , ctr nosule tension rings , microscope bulbs 15v 150w , moxifloxacin hcl 0 point 5 percent plus prednisolone 1 percent w v eye drop 5 ml , gatifloxacin hcl 0 point 3 percent plus prednisolone 1 percent w v eye drop 10 ml , malyugin ring , pva spears pkt of 10 , tropicamide 0 point 02 percent plus phenylephrine hcl 3 point 0 percent plus lidocain hcl 1 percent inj , iris hooks set of 5 , hydroxypropyl methycellulose hypermellose ups 3 gm carbomer 9802 point 2mg sorbitol dequest 2060 5slerile lubricant eye gel 10gm , fluriscein strip , acetazolamide 500mg tab , travoprost 0 point 004 percent with timolol 0 point 5 percent with polyquad 0 point 001 percent bottle with dispensing plug and screw cap eye drop bott of 2 point 5ml , tab tranexamic acid 250 mg , tab norethisterone 10mg , syp melatonin , ung betamethsone 0 point 64 mg plus salicylic acid 30 mg tube of 10 gm , syp metoclopramide 5mg ml bott of 60ml , doxepine 10mg cap , syp vitamin d3 drop 100 iu ml bott of 15ml , tab mycophenolate mofetil 750 mg , tab estradiol valerate 2mg pack of 28 , tab repaglinide 2mg , tab repaglinide 3mg , enterogermina bacillus clausii spores oral suspension 5 ml , tab estradiol hemihydrate 2 mg , syp risperidone2 ponit 5mg 5ml , tab bilastine 10 mg , ketotifen fumarate 0 point 005 percent eye drops 5 ml , atropine sulphate oint 1 percent tube of 3 gm , eye pad with patch , vitamin d3 400 iu ml drops 15ml , ether solvent , enema sodium phoshate ml 6 percent sod acid phoshate 16 percent pack of 100ml , calcium phosphate syrup 80 mg 5 ml 200 ml bottle , clotrimazole plus beclomethasone plus lignocaine plus chloramphenicol bott of 10 ml ear drop , pulv neomycin plus polymixin b bott 10gm , ung benzoyl peroxide 5 percent , tab repaglinide 1mg , inj methylcobalamine 500mcg , azithromycin 500mg inj , syp prednisolone 5 mg ml bott of 30 ml , levonorgestrel iu system , ung imiquimod 5 percent , bss ophthalmic irrigation solution 500 ml with unoport technology

CTN :39298985

01 Apr, 2025 4.03 Lacs

Rajauri - Jammu And Kashmir

Tender For bid to ras supply of dextrose 50 percent inj , dextrose inj 25 percent in amp of 25 ml , potassium chloride liquid 20 percent bott of 200ml , sodium bicarbonate 7 point 5 percent amp of 10 ml , enteral feed powder protein 85 percent short chain peptides 15 percent free amino acids fat 50 percent mct 25 percent vet fat carbohydrate malto destri sachet of 126 gm , hemostatic sponge gelatin 80 mm long 50mm broad 10 mm thick , 0 point 5 percent chlorhexidine acetate bp tulle gauze dressing 10 x 10cm box of 10 , sildenafil citrate tab 50 mg , tab ascorbic acid 100 mg , b1 inj 50 mg vial , b 12 inj 500 mcg , calcium 9mg plus calcium gluconate 50mg inj for iv use 10ml , iron syrup paediatric each 5ml containing element iron 20 to 25mg folic acid 500mcg bott of 200 ml , multi vit inj iv 2 to10 ml with minimum constituents having thiamine b1 30mg per ml pyridoxine b6 30mg per ml and b12 cyanocobelemine 300mcg per ml , ethambutol 800 mg tab , fluticasone propionate cream 0 point 05 percent plus mupirocin 2 percent tube of 10gm , salmetrol 50 mcg plus fluticasone 250 mg multi dose dry powder inhaler of 60 doses , colchicine 0 point 5 mg tab , tab fexofenadine hydrochloride 120 mg , sulphamethoxazole 400 mg and trimethoprim 80mg tab septran , tab efavirenz 600 mg , zidovudine 300 mg tab , nitrofurantion 100mg tab , nitroglycerin 5mg per ml 5ml inj , antacid chewable comntaining dried aluminium hydroxide ip 250mg mag hydroxied nf 250mg methyl polysiloxane 50mg tab , syp zinc 20 mg per ml bott of 100 ml , tab dexamethasone 4mg , thiamine 100mg per ml inj of 2ml , inj diclofenac 75mg per ml 1ml amp for iv bouls , alcohol based antimicrobial hand gel containing ethyl alcohol 60 to 70 percent 2 propanol 60 to 70 percent , human diploid cell rabies vaccine monopack , inj anti rabies serum ip 300 iu per 5 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml 10 doses , anti rabies serum ip 5ml vial enzyme refined equine immunoglobulins potency not less than 200 iu per ml , rabies immune globulin human usp heat treated ampoule ampoule containing not less than 150 iu per ml of human anti rabies immunoglobulins 2ml ampoule per pfs , rifaximine 550 mg tab , polyethylene glycol purgative powder ip 118gm sod chloride 2 point 93 gm pot chloride 1 point 484 gm sod bicarb 3 point 37 gm sod sulphate 11 point 35gm , doxylamine succinate 10 mg usp plus pyridoxine hydrochloride 10 mg ip tab bid details/ 2 / 34

CTN :39278116

01 Apr, 2025 3.02 Lacs

Rajauri - Jammu And Kashmir

Tender For bid to ras tender for supply of thiopentone inj of 0.5 g without water for injection , bupivacaine hcl inj 5mg/ml heavy amp of 4 ml , lignocaine hcl inj 2%(without adrenaline) vial of 30ml(suitable for ophthalmic use also) , lignocaine hcl 2% with adrenaline(1 0000) vial of 30 ml inj , lidocaine/lignocaine hcl 2% with adrenaline/elinephrine (1 80 000) 1.8ml catrdige , lignocaine 100 mg & ethanol 28 mg/ml v/v spray container of 500/800 md , atropine sulphate 0.6mg in 1 ml amp , iso-propanol 60-65% and benzalkonium chloride skin disinfectant , 63gm/0.025 gm in 100 gm , 1 , 6 dihydroxy , 2-5 dioxahexane , gluteraldeyde benzylalkonium chl , alkyl urea derivative , 11.2gm/5.0gm 5gm/3gm in 100 gm , paracetamol with cysteine hcl monohydarte infusion 1000mg/100ml , paracetamol 10mg/ml infusion in 50ml bott , common cold tab (antihistiminics + paracetamol 325/500 mg without pseudoephedrine) , inj paracetamol 1gm (bott of 100ml) , diclofenac diethylamine bo 4.64 w/v equivalent to diclofenac sodium ip 4.00 w/v absolute ip 10.00v/v in topical solution base (non aqueous) q.s , indomethacin 75 mg sr tab , promethazine syp 5mg / 5ml bott of 6 ml , dexamethasone sodium phosphate inj 4.4 mg (equivalent to dexamethasone phosphate 4 mg/ml) vial of 2 ml , pheniramine maleate inj 22.75 mg per ml amp of 2 ml , tab methylprednisolone 16 mg , inj promethazine hcl 2.5% 25mg/ml , in 2 ml , pralidoxime inj 500mg per 20ml , carbamazepine tab 200 mg , carbamazepine 200 mg cr tab , clobazm tab 5 mg , clonazepam 2 mg tab , phenobarbitone sod inj 200mg in 1 ml amp , posphenytoin sodium 75mg/ml amp of 2ml inj , sodium valproate100mg/ml inj , sodium valproate 200 mg/5ml bottle of 100 ml syrup , topiramate 25mg tab , baclofen tab 10 mg , salmeterol 25mcg + fluticasone 250 mcg autohaler , ivermectin tab 6mg , tab diethylcarbamazine 50mg , clotrimoxazole ip paed 100mg + 20mg , dapsone 50 mg tab , tab amitriptyline 25 mg , artesunate (a) + sulphadoxine-pyrimethamine (b) combi pack (b) 1 tab 25mg (a)+1 tab (250mg+12.5mg) , amphotericin-b inj 50 mg vial , clotrimazole mouth paint 1% bottle of 15 ml , fluconazole infusion inj 2 mg/ml 100 ml bott , cap hydroxyurea 500 mg , methotrexate 2.5mg tab , tab trihexyphenidyl hcl 2 mg , acenocoumarol 1 mg tab , inj tranexamic acid 500 mg/5ml , choline salicylate and benzalkonium chloride gel of 10 mg , tab diltiazem controlled delivery) 90mg , fenofibrate 200 mg tab , isosorbide dinitrate tab 10 mg , tab glyceryl trinitrate cr 2.6 mg , inj adenosine 3 mg/ml 10 ml , amiodarone hcl 150 mg ml inj in 3 ml amp , metoprolol inj 1 mg/ml amp of 5 ml , propranolol tab 40 mg (indral) , ramipril tab 2.5 mg , digoxin tab 0.25 mg , digoxin 0.5 mg inj , dopamine hcl 40 mg/ml in amp of 5 ml inj , tab asprin 75 mg , clonidine tab 100 mcg , hydrochlorthiazide 25 mg tab , prazosin 2.5mg sustained release/slow release tab , prazosin 5mg sustained release/slow release tab , metoprolol 12.5mg tab , nicorandil 5mg tab , antiseptic mouth wash containing sodium fluoride & triclosan bott of 100 ml , benzocaine 20% , pectin based oral ointment tube of 5 gm , clove oil bottle of 50ml , desensitising paste (stannous fluoride/pottaslum nitrate/sodium monofluoride-phosphate) tube of 40-55 ml or gm , calamine 8% with 10% light liquid paraffin 50ml bott , betamethasone dipropionate usp 5mg and gentamycin sulphate 1mg/gm tube of 5gm , zinc oxide /titanium dioxide bott (spf 25-50) (sunscreen lotion) bottle of 60 ml

CTN :39278239

31 Mar, 2025 3.05 Lacs

Rajauri - Jammu And Kashmir

Tender For bid to ras tender for supply of aa pencil cell , aaa + pencil cell , estradiol 2mg + dydrogesterone 10 mg , syp multivitamin , multiminerals with lycopene bott of 200 ml , protein powder (bott of 500 gm) , tab rabeprazole 20mg , ketoconazole shampoo( bottl of 100ml ) , biotin 10mg tab , revital cap , calcium syp (shelcal) , sunscreen gel , levetiracetam 1 gm tab , neurobion forte tab , tab voglibose 0.3 mg , tab pantoprazole 40mg +domperidone10mg , levosalbutamol inh 50 mcg , tab rabeprazole 20 mg + levosulpride 75mg , inj multivitamin with folic acid , tab calcium 150 mg (in form of calcium hydroxide and calcium oxide pretreated with heated algae) + cholecalciferol 500iu (triple-a-cal) , mouth ulcer gel containing choline salicylate + lignocaine tube of 10 gm , analgesic spray containing diclofenac diethylamine 1.16%w/v , methly salicylate 10% w/v , menthol 5%w/v , linseed oilbp-3.00%wv exceiptent & propellent qs 100% w/v , 50-75gm , burn relief spray containing lidocain usp 3.0%w/w benzeth onion chloride usp 0.20%w/w and , cream clobetasol propionate 0.05% salicylic acid 6% 20gm , tab gabapentin 300mg + methylcobalamine 500mcg , glucosamine 500 mg + chondrion sulphate 400 mg (rejoint) tab , inj methylcobalamine 1500mcg , pregabalin 75 mg + methylcobalmin 750 mcg tab , syp ibuprofen 100mg + paracetamol 16.2mg/5ml bott of 100ml (combiflam) , syp paracetamol 250mg/5ml bott of 60ml , calamine lotion 1% bott of 100ml , cream betamethasone dipropionate usp 0.10% w/w gentamycin sulphate 0.1% w/w and miconazole nitrate 2% w/w tube of 20 gm , vitamin e 400mg tab , hydrochlorthiazide 12.5mg tab (aquazide) , neomycin 3400iu , polyxamine b sulphate 5000iu , zinc bacitran 400iu , per gm powder , bott of 10gm , ursodeoxycholic acid 300mg tab , tab zinc sulphate monhydrate 61.8 mg , vit b1 1 mg , vit b2 10mg , vit b6 2 mg , vit b12 2 mg , nicotinamide 75 mg , panthonate 25 mg , vit e 20 mg , vit c 150 mg , prednisolone 20 mg tab , tab clinidipine 10mg , diclofenac transdermal patch 200 mg

CTN :39858886

18 Apr, 2025 10.65 Lacs

Ferozepur - Punjab

Tender For supply of acebrophyllin 100mg acetycstine 600mg pulmoclear tab , acetaminophen 325 mg plus tramadol 37.5 mg ultracet tab , alovera and vitamin e lotion , alprazolam 0.5 mg tab , amitriptyline 10 mg tab , aripiprazole 5 mg tab , aspirin 75 mg plus atorvastatin 10 mg plus clopidogril 75 mg tab , aspirin 75 mg plus atorvastatin 20 mg plus clopidogril 75 mg tab , asthalin respules levolin resp , azelasartan 40 mg tab , baclofen 20 mg tab , betahistine 24 mg tab , brivaracetam 100mg tab , calcium vit d3 syp 200ml bott , calcium carbonate plus calcitirol plus methulcobalamin plus vitamin k2 and zinc tab , capesitabine 400mg plus cyclophosphamide 20mg tab , carbamazepine 200 mg cr tab , cefuroxime 500mg plus clavuclonic acid 125 mg tab , chlordiazepoxide 5 mg plus clidinium bromide 2.5 mg , chlorhexidine mouthwash 2 perc bottle of 150 ml , cilinidium plus chlordiazepoxide plus dicyclomine tab , cinitapride 3mg plus pantoprazole 40mg tab , clarithromycin 250mg tab , clobetasol plus gentamicin oint , clonazepam 2 mg tab , clopidogrel 75 mg plus aspirin 75 mg tab , clozapine 100 mg tab , coenzyme q10 100 mg tab , coenzyme q300 mg tab , collagen peptide plus hyaluronate tab , combipack of amoxicillin 750mg plus tinidazole 500 mg plus omeprazole 20 mg hp kit , daflon 500mg diosmin 450mg plus hesperidin 50mg tab , dapagliflozin 10 mg plus metformin 500 mg tab , dienogest 2mg tab , disodium hydrogen citrate syrup , donepezil 5mg plus memantine 10mg tab , drotaverine hcl 40 mg tab , ed bimatoprost 0.01 perc , ed nepafenac 0.1perc w v , ed olopatadine plus ketorolac bott of 10ml , ed potassium iodide sodium chloride and calcium chloride calodin 5 ml , ed travaprost plus timolol bott of 10ml , enteral feed powder protein 85 perc short chain peptides 15perc free amino acids fat 50 perc mct 25 perc vet fat carbohydrate malto destri sht of 126gm , eperisone 50 mg tab , escitalopram 5 mg plus clonazepam 0.5 mg , escitalopram 5 mg plus clonazepam 0.5 mg tab , evening primarose 1000 cap , fenofibrate 200mg plus atorvastatin 10mg tab , flupentixol 0.5 mg plus melitracen 10 mg tab , flurbiprofen 0.03 perc eye drop , fungal diastace plus papaine plus activated charcol unienzyme , ginkgo biloba tab , glimepiride 2mg metformin 500mg tab , glimepiride 2 mg plus metformin 500 mg sustained release tab , glucose powder , heparin 15g 20g oint , human insulin analogue aspart premix 30 per insulin 70 per insulin protamine aspart suspension 100 iu ml 3 ml pfs , hydrochlorothiazide 12.5 mg tab , indapamide 1.5mg tab , inh beclomethason 200mcg 200 meter dose inh , inh salmeterol 25mcg plus fluticasone 125mcg 120 mdi , inh triohale tiotropium bromide 9 mcg plus formoterol 6 mg plus ciclesonide 200mcg 200 meter dose inh , inj degludec insulin aspart ryzodeg , inj filgrastim 300 mcg , inj human mixtard 30-70 , inj insulin liraglutide 6mg ml 18mg pen , insulin humalog lispro inj recombinan dna origin 100iu mlcartidge , isosorbid 5 mg monontrate 30 mg tab , isosorbid mononitrate 10 mg tab , isosorbide dinitrate 5 mg tab , ketoconazole shampoo , ketoralac 0.2 perc e d , l carnitine 500mg tab , levocarnitine 500 mg tab , lignocain plus gabapentin oint , linagliptin 5 mg plus empagliflozin 10 mg tab , liq paraffin 100 ml bott , losartan 50mg plus hydrochlorthiazide 12.5mg tab , memantine 5 mg plus donepezil 5 mg tab , mesalamine 400 gm tab , metolazone 2.5 mg tab , metoprolol xl 12.5 mg tab , midodrine 10mg tab , minoxidil 5 perc w v lotion 60 ml , mirabegron 25mg plus solifenacin 5mg tab , mirtazapine 7.5 mg tab , montelukast plus bid details/ 2 / 152 levocetrizine plus acebrophylline 200mg tab , multivitamin plus multimineral tab , multivitamin syp , nandrolone deconate 50 mg inj , nasal spray calcitonin 200iu , nepafenac 0.3 perc w v5 ml ed , nifedipine retard 10 mg tab , nitroglycerin 2.6 mgtab , omega 3 fatty acid cap , omega fatty acid plus antioxidant cap , powder clotrimazole 75 gm , propranol 40 mg tab , rabeprazole 20 mg plus levosulpride 75mg tab , rabeprazole

CTN :39850456

11 Apr, 2025 NA

Saharsa - Bihar

Tender For purchase and installation of practical equipment in various educational institutions under saharsa district - moving coil galvanometer , moving coil voltmeter , moving coil ammeter , micro ammeter , sonometer , apparatus to determine relationship between the frequency and tension, length & mass , battery eliminator , tunning fork electrically , apparatus to investigate standing waves on a string. , meter bridge , experiment to determine the unknown resistance of a conductor. , potentiometer experiments to measure the internal resistance of a cell. , deflection magnetometer experiments to measure the deflection of a compass needle by magnetic field , tangent galvanometer apparatus for measurement of the direction & power of current , dry cell , analytical digital weighing scale , bar magnate 50mm, m name , u magnate , mirror fl 4 concave 50mm , mirror convex 50mm , mercury thermometer c/f/r , micrometer screw gauge 15mm , apparatus to measure the dimensions of object with high precision. , eliminator 4amp , meter bridge 100cm long , friction apparatus , dcc copper wire insulated , glass slab 75x50x18mm , lenses concave 50mm , lenses convex 50mm , measuring cylinder 500ml poly to measure the volume of liquid , double disc spherometer , apparatus curvature to measurement of radius of , vernier calipers apparatus to studying expansion of material, charts of newton's second law , charts of ohms law , charts of electro magnate , charts of telescope , charts of reflection of light , charts of refraction of light , charts of newton's law of motion , charts of 4 stroke engine , charts of electron microscope , charts of magnate , mirror stand metallic adjustable , pin stand adjustable metallic , tripod stand , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , rheostat , apparatus to variable change of resistance , lechlanche cell , stop clock , equilateral glass prism 50mm , magnetic compass both side glass , zinc plate with terminal , copper plate with terminals , zinc rod with terminal , manganine coil resistance box 100.ohms , magnesium metal ribbon coil, analytical digital weighing scale , test tube stand , holder hold for glass wares , burette clamp , tripod stand to support glassware , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , gas jar with cover 6x2 , conical flask 250ml , round bottom flask 250ml , flat bottom flask 250ml , reagent bottle 250ml poly , reagent bottle 500ml poly , wash bottle 250ml , test tube 5x1/8 , measuring flask 250ml , pipette 10ml , filter paper 100.circle 12.5 cm dia. whatsman's , test tube holder, tongs , test tube brush , spirit lamp , spatula , conical funnel 75mm , digital conductivity meter , chemical weight box , desiccators with lid glass , atomic model sets , bunsen burner , motor & pestle(porcelain)-3" , beehive shelves(porcelain)-3" , crucible with lid , red litmus paper , blue litmus paper, chart of hydrogen gas , structure of atom , chemical bonding , manufacturing of soap , rutherford atomic model , charts of water purification , charts of bleaching powder manufacturing , charts of nuclear energy , charts of petroleum , sodium hydroxide , phenolphthalein indicator solution , methyl orange indicator solution , sodium carbonate , sodium bicarbonate , calcium chloride , calcium carbonate , ferrous sulphate , blue litmus paper , red litmus paper, compound microscope , apparatus for viewing samples at high magnification. , dissecting microscope , low power microscope , staining rack , empty jar specimens with cover , mounting slides , cavity slides , beaker 500ml pp , beaker 250ml pp , conical flask 250ml borosilicate , conical flask 500ml borosilicate , wash bottle poly 250ml , f.b. flask 250ml borosilicate , test tube borosilicate 150x25mm , measuring cylinder poly 250ml , reagent bottler 250ml poly , petri dish , watch glass 75mm , cover slip , ph paper , test tube stand, charts: human skeleton system , , human nervous system , human hea

CTN :39856104

07 Apr, 2025 2.50 Lacs

Multi City - Karnataka

Tender For purchasing of chemicals consumables to chemistry research center gec ramanagara-, , zinc nitrate hexahydrate [zn(no3)2. 6h2o], , cerium nitrate hexahydrate [ce(no3)3. 6h2o], , chromium nitrate nonahydrate [cr(no3)3 .9h2o], , cobalt nitrate hexahydrate [co(no3)2.6h2o], , copper nitrate hexahydrate [cu(no3)2.6h2o], , silver nitrate [agno3], , titanium nitrate [ti(no3)4], , magnesium nitrate hexahydrate [mg(no3)26h2o], , nickle nitrate hexahydrate [ni(no3)26h2o], , cadmium nitrate [cd(no3)2], , chromium (iii) nitrate nonahydrate [cr(no3)3.9h2o], , sodium nitrate (nano3), , sodium nitrite (nano2), , strontium nitrate [sr(no3)2], , bismuth nitrate [bi(no3)3)], , iron nitrate (ferric nitrate) [fe(no3)3.(h2o)n], , zirconium nitrate [zr(no3)4], , gadalonium nitrate [gd(no3)3], , tin (iv) chloride pentahydrate [sncl45h2o], , titanium isopropoxide [ti{och(ch3)2}4.], , niobium (v) nitrate [nb(no3)5], , ammonium nitrate (nh4no3), , zinc sulphate (znso4), , copper sulphate (cuso4), , magnesium sulphate heptahydrate (mgso4.7h2o), , nickle sulphate hexahydrate (niso46h2o), , chromium sulphate hexahydrate [cr2(so4)36h2o], , cerium sulphate hexahydrate [ce(so4)26h2o], , manganese acetate tetrahydrate [mn(ch3coo)24h2o], , zinc acetate heptahydrate [zn(ch3coo)27h2o], , zinc acetate hexahydrate [zn(ch3coo)26h2o], , chromium acetate [cr(ch3coo)2], , tetraethyl orthosilicate (teos) [si(oc2h5)4], , sodium silicate (na2sio3), , sodium metasilicate pentahydrate [na2sio35h2o], , sodium metavanadate [navo3], , vanadyl sulphate hydrate [voso4.xh2o], , chromium sulphate [cr2(so4)3], , ammonium, , tungstate, , pentahydrate, , [(nh4)10(h2w 12042)5h2o], , ammonium vanadate (nh4vo3), , sodium tungstate dihydrate (na2wo4.2h2o), , tungsten hexacarbonyl [w(co)6], , tungsten hexachloride (wcl6), , sodium bicarbonate (nahco3), , sodium hydroxide (naoh), , sodium chloride (nacl), , sodium sulphate (na2so4), , sodium lauryl sulphate (sls), , sodium dodecyl sulphate (sds), , cetyl trimethyl ammonium bromide (ctab), , boric acid (h3bo3), , ammonium hydroxide (nh4oh), , ammonium chloride (nh4cl), , hydrochloric acid (hcl), , sulphuric acid (h2so4), , ethylenediaminetetraacetic acid (edta) [c10h16n2o8], , potassium hydroxide (koh), , ethanol (c2h5oh), , urea [nh2conh2], , glycine [c2h3no2], , 2, , 4, , citric acid [c6h8o7], , acetone [ch3coch3], , nickel mesh (to prepare working electrode), , nickle foam, , 6, , nafion [c7hf13o5s c2f4], , 7, , whatmann filter paper (no. 41), , tissue paper (laboratory grade)

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

Sodium Oxalate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector