Get complete information related to latest Sodium Oxalate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Sodium Oxalate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Sodium Oxalate Tenders.
Tender For supply of medicine - inj bleomycin sulphate 15 units vial , hydrocortisone acetate cream 1 percent ww tube of 15 gm , cap minocycline er 65 mg , tab minoxidil 2 point 5 mg , clobetasol propionate 0 point 05 percent w w plus buffered lactic acid 12 percent w w 30 gm gel , zinc oxide and benzalkonium chloride cream tube of 30 gram , 0 point 1 percent triamcinolone acetonide bucccal parts 7 point 5 gm tube , calcium pantothenate tablet 200 mg , lot padophyllin resin 20 percent bott of 10ml , tab acetretin 10 mg , clindamycin 1 percent w v benzoyl peroxide 5 percent w w gel 20gm , cyclophosphamide 500 mg inj , lot lactic acid 17 percent plus salicylic acid 17 percent bott of 15ml , lot ciclopirox 1 percent w v zinc pyrithidone 1 percent 100ml , cyclosporine eye drops 0 point 05 percent bott of 3 ml , ketorolac tromethamine 0 point 4 percent eye drops 5 ml , brimonidine tartrate 0 point 2 percent eye drops 5 ml , ctr nosule tension rings , microscope bulbs 15v 150w , moxifloxacin hcl 0 point 5 percent plus prednisolone 1 percent w v eye drop 5 ml , gatifloxacin hcl 0 point 3 percent plus prednisolone 1 percent w v eye drop 10 ml , malyugin ring , pva spears pkt of 10 , tropicamide 0 point 02 percent plus phenylephrine hcl 3 point 0 percent plus lidocain hcl 1 percent inj , iris hooks set of 5 , hydroxypropyl methycellulose hypermellose ups 3 gm carbomer 9802 point 2mg sorbitol dequest 2060 5slerile lubricant eye gel 10gm , fluriscein strip , acetazolamide 500mg tab , travoprost 0 point 004 percent with timolol 0 point 5 percent with polyquad 0 point 001 percent bottle with dispensing plug and screw cap eye drop bott of 2 point 5ml , tab tranexamic acid 250 mg , tab norethisterone 10mg , syp melatonin , ung betamethsone 0 point 64 mg plus salicylic acid 30 mg tube of 10 gm , syp metoclopramide 5mg ml bott of 60ml , doxepine 10mg cap , syp vitamin d3 drop 100 iu ml bott of 15ml , tab mycophenolate mofetil 750 mg , tab estradiol valerate 2mg pack of 28 , tab repaglinide 2mg , tab repaglinide 3mg , enterogermina bacillus clausii spores oral suspension 5 ml , tab estradiol hemihydrate 2 mg , syp risperidone2 ponit 5mg 5ml , tab bilastine 10 mg , ketotifen fumarate 0 point 005 percent eye drops 5 ml , atropine sulphate oint 1 percent tube of 3 gm , eye pad with patch , vitamin d3 400 iu ml drops 15ml , ether solvent , enema sodium phoshate ml 6 percent sod acid phoshate 16 percent pack of 100ml , calcium phosphate syrup 80 mg 5 ml 200 ml bottle , clotrimazole plus beclomethasone plus lignocaine plus chloramphenicol bott of 10 ml ear drop , pulv neomycin plus polymixin b bott 10gm , ung benzoyl peroxide 5 percent , tab repaglinide 1mg , inj methylcobalamine 500mcg , azithromycin 500mg inj , syp prednisolone 5 mg ml bott of 30 ml , levonorgestrel iu system , ung imiquimod 5 percent , bss ophthalmic irrigation solution 500 ml with unoport technology
Tender For bid to ras supply of dextrose 50 percent inj , dextrose inj 25 percent in amp of 25 ml , potassium chloride liquid 20 percent bott of 200ml , sodium bicarbonate 7 point 5 percent amp of 10 ml , enteral feed powder protein 85 percent short chain peptides 15 percent free amino acids fat 50 percent mct 25 percent vet fat carbohydrate malto destri sachet of 126 gm , hemostatic sponge gelatin 80 mm long 50mm broad 10 mm thick , 0 point 5 percent chlorhexidine acetate bp tulle gauze dressing 10 x 10cm box of 10 , sildenafil citrate tab 50 mg , tab ascorbic acid 100 mg , b1 inj 50 mg vial , b 12 inj 500 mcg , calcium 9mg plus calcium gluconate 50mg inj for iv use 10ml , iron syrup paediatric each 5ml containing element iron 20 to 25mg folic acid 500mcg bott of 200 ml , multi vit inj iv 2 to10 ml with minimum constituents having thiamine b1 30mg per ml pyridoxine b6 30mg per ml and b12 cyanocobelemine 300mcg per ml , ethambutol 800 mg tab , fluticasone propionate cream 0 point 05 percent plus mupirocin 2 percent tube of 10gm , salmetrol 50 mcg plus fluticasone 250 mg multi dose dry powder inhaler of 60 doses , colchicine 0 point 5 mg tab , tab fexofenadine hydrochloride 120 mg , sulphamethoxazole 400 mg and trimethoprim 80mg tab septran , tab efavirenz 600 mg , zidovudine 300 mg tab , nitrofurantion 100mg tab , nitroglycerin 5mg per ml 5ml inj , antacid chewable comntaining dried aluminium hydroxide ip 250mg mag hydroxied nf 250mg methyl polysiloxane 50mg tab , syp zinc 20 mg per ml bott of 100 ml , tab dexamethasone 4mg , thiamine 100mg per ml inj of 2ml , inj diclofenac 75mg per ml 1ml amp for iv bouls , alcohol based antimicrobial hand gel containing ethyl alcohol 60 to 70 percent 2 propanol 60 to 70 percent , human diploid cell rabies vaccine monopack , inj anti rabies serum ip 300 iu per 5 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml 10 doses , anti rabies serum ip 5ml vial enzyme refined equine immunoglobulins potency not less than 200 iu per ml , rabies immune globulin human usp heat treated ampoule ampoule containing not less than 150 iu per ml of human anti rabies immunoglobulins 2ml ampoule per pfs , rifaximine 550 mg tab , polyethylene glycol purgative powder ip 118gm sod chloride 2 point 93 gm pot chloride 1 point 484 gm sod bicarb 3 point 37 gm sod sulphate 11 point 35gm , doxylamine succinate 10 mg usp plus pyridoxine hydrochloride 10 mg ip tab bid details/ 2 / 34
Tender For purchase and installation of practical equipment in various educational institutions under saharsa district - moving coil galvanometer , moving coil voltmeter , moving coil ammeter , micro ammeter , sonometer , apparatus to determine relationship between the frequency and tension, length & mass , battery eliminator , tunning fork electrically , apparatus to investigate standing waves on a string. , meter bridge , experiment to determine the unknown resistance of a conductor. , potentiometer experiments to measure the internal resistance of a cell. , deflection magnetometer experiments to measure the deflection of a compass needle by magnetic field , tangent galvanometer apparatus for measurement of the direction & power of current , dry cell , analytical digital weighing scale , bar magnate 50mm, m name , u magnate , mirror fl 4 concave 50mm , mirror convex 50mm , mercury thermometer c/f/r , micrometer screw gauge 15mm , apparatus to measure the dimensions of object with high precision. , eliminator 4amp , meter bridge 100cm long , friction apparatus , dcc copper wire insulated , glass slab 75x50x18mm , lenses concave 50mm , lenses convex 50mm , measuring cylinder 500ml poly to measure the volume of liquid , double disc spherometer , apparatus curvature to measurement of radius of , vernier calipers apparatus to studying expansion of material, charts of newton's second law , charts of ohms law , charts of electro magnate , charts of telescope , charts of reflection of light , charts of refraction of light , charts of newton's law of motion , charts of 4 stroke engine , charts of electron microscope , charts of magnate , mirror stand metallic adjustable , pin stand adjustable metallic , tripod stand , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , rheostat , apparatus to variable change of resistance , lechlanche cell , stop clock , equilateral glass prism 50mm , magnetic compass both side glass , zinc plate with terminal , copper plate with terminals , zinc rod with terminal , manganine coil resistance box 100.ohms , magnesium metal ribbon coil, analytical digital weighing scale , test tube stand , holder hold for glass wares , burette clamp , tripod stand to support glassware , measuring cylinder graduated poly 500ml , beaker borosilicate 250ml , gas jar with cover 6x2 , conical flask 250ml , round bottom flask 250ml , flat bottom flask 250ml , reagent bottle 250ml poly , reagent bottle 500ml poly , wash bottle 250ml , test tube 5x1/8 , measuring flask 250ml , pipette 10ml , filter paper 100.circle 12.5 cm dia. whatsman's , test tube holder, tongs , test tube brush , spirit lamp , spatula , conical funnel 75mm , digital conductivity meter , chemical weight box , desiccators with lid glass , atomic model sets , bunsen burner , motor & pestle(porcelain)-3" , beehive shelves(porcelain)-3" , crucible with lid , red litmus paper , blue litmus paper, chart of hydrogen gas , structure of atom , chemical bonding , manufacturing of soap , rutherford atomic model , charts of water purification , charts of bleaching powder manufacturing , charts of nuclear energy , charts of petroleum , sodium hydroxide , phenolphthalein indicator solution , methyl orange indicator solution , sodium carbonate , sodium bicarbonate , calcium chloride , calcium carbonate , ferrous sulphate , blue litmus paper , red litmus paper, compound microscope , apparatus for viewing samples at high magnification. , dissecting microscope , low power microscope , staining rack , empty jar specimens with cover , mounting slides , cavity slides , beaker 500ml pp , beaker 250ml pp , conical flask 250ml borosilicate , conical flask 500ml borosilicate , wash bottle poly 250ml , f.b. flask 250ml borosilicate , test tube borosilicate 150x25mm , measuring cylinder poly 250ml , reagent bottler 250ml poly , petri dish , watch glass 75mm , cover slip , ph paper , test tube stand, charts: human skeleton system , , human nervous system , human hea
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76