Sodium Petroleum Sulphonate Tenders

Get complete information related to latest Sodium Petroleum Sulphonate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Sodium Petroleum Sulphonate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Sodium Petroleum Sulphonate Tenders .

Filter

Loading....

Get Tender in Email

CTN :40004863

02 May, 2025 NA

Mathura - Uttar Pradesh

Tender For supply of pathological items - internal filling solution for electrolyte analyzer , solution pack of 800ml , cleaning solution kit of 6x15ml , easylyte trilevel control of 3x10ml , sodium electrode for easy lite analyzer , potassium electrode for easy lite analyzer , multistix 10sg pack of 100 stix , check stix combo pack control , ready made water culture tubes double strength mac conkey broth , bhi broth prepared media for blood culture , mac conkey agar powder bott of 500 gm , cled agar powder bott of 500 gm , blood agar base powder bott of 500 gm , muller hinton agar powder bott of 500 gm , occult blood kit 1x10 test , pm kit em 200 fully automated biochemistry analyzer , chloroform absolute , xylene sulfer free , ethyl alcohol absolute , methyl alcohol absolute , glycerine , formaldehyde 40 percent solution , acetone , tissue embedding ring pack size 500 , single reaction cuvette src 10 erbaecl 105 coagulation test , gills iii hematoxylin stain solution , sample cups size 2 ml for em 200 bio analyzer , g6pd qualitative test pack size 10 tests , anti a and b and d blood grouping combo kit , scrub typhus igg and igm rapid kit 1x20 test , aborh grouping gel card pkt of 24 cards , liss solution for gel card cell suspension 250ml , uniplastin pack of 12x5ml , liquicellin pack of 3ml , calcium chloride pack of 5ml

CTN :39896985

24 Apr, 2025 NA

Silvassa - Gujarat

Tender For supply of laboratory materials - cotton swab with wooden stick , autoclavable disposable bag , h2s test strip modify for water testing , blood culture bottle with bhi adult , blood culture bottle with bhi pediatric , aluminum foil , disposable petridish , ast n405 , ast gp 628 , ast n406 , ast st 03 , ast yeast ast y508 , autoclavable pipette , autoclavable pipette tips , cryotubes 1.8ml , early ns1 elisa for dengue , early igm elisa for dengue , gn test kit vtk2 , gp test kit vtk2 , hepatitis a rapid , hepatitis e rapid , leptospira igm elisa igm , suspension solution , unsensitised tube , uricol , vibrio cholerac antisera , yst test kit vtk2 , sterile cotton swab in polypropylone , hiv elisa , hbsag igm elisa , hcv igm elisa , loop holder , sterile disposable petridish , anerogen pack , macconkey agar , peptone, bacteriological , s s agar selective agar , sabouraud dextrose agar , susceptibility test amikacin , susceptibility test ampicillin , susceptibility discs aztreonam , susceptibility discs cefepime , susceptibility discs ceftazidime , susceptibility test ceftriaxone , susceptibility test gentamycin , susceptibility discs imipenem , susceptibility discs netilmi , susceptibility test ofloxacin , susceptibility discs vancom , susceptibility discs nitrofur , susceptibility amoxyc , susceptibility ciproflo , susceptibility cefotaxiom , susceptibility tetracycline , susceptibility doxycycline , susceptibility levofloxacin , susceptibility clindamycin , susceptibility linezolide , susceptibility cefoperazone , susceptibility meropenam , susceptibility piperacillin , susceptibility cefazoline , susceptibility cefuroxime , susceptibility cefixime , susceptibility colositin , susceptibility chloramphenicol , susceptibility fosfpmycine , co- trimoxazole sulpha , high level gentamicin , polymixin b , susceptibility ketoconazole , susceptibility nystatin , susceptibility fluconazole , susceptibility amphotericin , susceptibility itraconazole , susceptibility miconazole , susceptibility clotrimazole , susceptibility novobiocin , susceptibility bacitracin , susceptibility optochin , oxidase discs , muller hinton agar , simmons citrate agar , triple sugar iron , phenylalanine agar , indian ink , kovac iodole regaent , cover slip , whatmans filter paper , metaloop ch2 , nichrome loop-d-1 , test tubes , zn stain , corn meal agar , potato dextrose agar , trichophyton agar 1 , trichophyton agar 2 , trichophyton agar 3 burners , sulphosalicylic acid , fouchet reagent ready to use , ehrlichs aldehyde , benzidine powder, hydrogen peroxide solution , hutchisons student spirometer , hot air oven , jaeger chart for near vision, snellen chart for far vision , distilled water, abo blood group antisera kit , rbc diluting fluid bottle, wbc pipette, rbc pipette, n10 hci , surgical spirit , tooth prick stick bundle , watch glass, round filter paper box , small size dropper, cedar wood oil , lancet box , beaker , potassium permaganate, pink filter paper big size, glass starrier for hb , glucose kit , total protein kit , albumin kit , cholesterol kit , urea kit , hdlc kit , triglycerides kit, tbil dbil kit , calcium kit , inorganic phosphorous kit , ast kit , alt kit , alp kit , micropipette , sulphur powder , sodium chloride , acetone , sodium hydroxide pellets, phenolphthalene , silver nitrate , sodium nitroprusside , potassium hydroxide , methylene blue reagent , bilirubin powder , bovine albumin, egg albumin , urea , sodium taurocholate , methanol , conc. hn03 , conc. hcl , ammonium hydroxide , picric acid semisolid , creatinine powder , eppendorf tubes , ph paper strip, stainless steel spatula , stainless steel spatula , beaker low form with spout , beaker low form with spout , plastic bid details/ 2 / 169

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Sodium Petroleum Sulphonate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector