Web Analytics Made Easy - StatCounter

Sodium Sulfate Tenders

Get complete information related to latest Sodium Sulfate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Sodium Sulfate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Sodium Sulfate Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39796668 Due date: 25 Mar, 202525 Mar, 2025 NA
Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39222391 Due date: 28 Mar, 202528 Mar, 2025 NA
Tender For bid to ras supply of chemicals for preparaion of green primary explosives - 5 aminotetrazole monohydrate purity greater than 98 percent pack of 100 g as per qap no hemrl meg gpe rm 001 , copper ii sulfate pentahydrate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 002 , sulfuric acid purity greater than pack of 2 point 5 lit as per qap no hemrl meg gpe rm 004 , celite 545 purified calcined , ph equal to tilde 8 pack of 1 kg as per qap no hemrl meg gpe rm 005 , copper i chloride reagent plus purified purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 006 , 3 bromoanisole purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 007 , aminoguanidinium bvicarbonate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 008 , ammonium acetate acs reagent purity greater than 97 percent pack of 500 g as per qap no hemrl meg gpe rm 009 , silver nitrate acs reagent purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 010 , ammonium iron iii sulfate dodecahydrate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 011 , ammonium thiocyanate acs reagent purity greater than 97 point 5 percent pack of 500 g as per qap no hemrl meg gpe rm 012 , 1 butanol acs reagent purity greater than 99 percent pack of 500 ml as pe qap no hemrl meg gpe rm 013 , glacial acetic acid acs reagent purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl meg gpe rm 014 , potassium dichromate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 015 , sodium hydroxide purity greater than 98 percent pack of 500 g as per qap no hemrl qap naoh 2024 317 , acetone purity greater than 99 point 5 percent pack of 2 point 5 lit as per qap no hemrl qap rm acetone 2023 52 , isopropyl alcohol purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl qap rm ipa 2023 43 , potassium hydroxide purity greater than 85 percent pack of 500 g as per qap no hemrl qap koh 2024 319 , sodium azide purity greater than 99 percent pack of 500 g as per qap no hemrl qap sodium azide 2024 360 , nitric acid purity greater than 70 percent pack of 2 point 5 lit as per qap no hemrl qap rm nitric acid 2023 54 , sodium nitrite purity greater than 96 percent pack of 500 g as per qap no hemrl meg gpe rm 003

Central Government And Public Sector

CTN :39711374 Due date: 15 Apr, 202515 Apr, 2025 4.97 Crore
Tender For tender for rate contract supply of drugs items to bims belagavi - zince oxide 20gm cream, zinc syrup 60 ml , xylometazoline 0.1% nasal drops 10ml, white petrolium 100% pure jelly 500gm, white petrolium 100% pure jelly 30gm, wax solvent ear-drops 10ml benzocaine 2.7%w/v+chlorbutol5%w/v+paradichlorobenzene2%w/v+turpentine oil-15%w/v, vitamin-e drops 50mg/1ml-15 ml, vitamin-d3 60000 iusachet, vitamin d3 400-iu 15ml (drops), vitamin b complex 200ml (syrup), vitamin a syrup (60 ml), vitamin a solution (100ml), ultra sound gel (5kg), turpentine oil (100ml), tropicamide- 5ml eye drops , triple combination cream (momethasone 0.25% with tretin 0.1% with hydroquinone 2.0%) 15 gm, triamcinolone 0.1% w/v 5gm oral ointment, tretinoin 0.025% cream , topical5% emla cream 15gm, topical lignocaine 25mg/g, prilocaine 25mg/g cream-5%- 5 gm (cream), tobramycine 0.3%10ml (eye drops), tincture benzoine (100ml), timolol maleate 10ml eye drops, thrombophobe ointment (20gm), theophylline with etophylline (200ml syrup), sucralphate (170ml syrup), soft roll (15cm x3mtr), soft roll (10cm x3mtr), sodium valproate 200mg/100ml (syrup), sodium phosphate enema (100 ml), sodium hypochloride 5-6% solution 5ltr, sodium hypochloride 5-6% solution 20litr, sodium chloride (nasal drops), sodium by carbonet ip 600gms with sodium-chloride ip 230gms t packets 1x830, silymarin l-ornithine l-asparatate (200 ml syp), silver sulphadiazine -15gm cream, silver sulphadiazine -100gm cream, sildenafil oral suspension 10 mg/ml, salbutamol-nebulisation repsules 2.5mg 2.5ml (amp), salbutamol- nebuliser solution (salbutamol 100microgram/actuation pressurised inhalation 200 actuations(pi,cmi)-15ml., salbutamol 2mg (100ml syrup), prednisolone acetate 1% + hpmc 0.25%-5 ml eye drop , povidone iodine solution in dark plastic bottle 500ml 5% w/v (500ml), povidone iodine ointment 5%w/v (15gm), povidone iodine ointment 5%w/v (125gm), povidone iodine cleansingsolution in dark plastic bottle 7.5 %w/v (500ml), potassium chloride (200ml syrup), pop roll 2.7 mtr x 15 cm (1roll), pop roll 2.7 mtr x 10 cm (1roll), phenytoin sodium 125mg (100ml syp), phenobarbiton 20 mg/5 ml-(100ml syp), permethrin 5% 30gm ointment, paracetamol 125mg/100ml (syrup), ors (who formula) 21gm, orodispersible probiotic sachets 2 gm-10 (sachets.), ondansetron 4mg/5ml 30ml (syrup), nuprep gel (114 gm), normal saline nasal 10ml drops, neomycin sulphate, polymyxin b sulfate and hydrocortisone 5 ml ear drop-, natamycin 5ml eye drops, mupirocin 2% 5gm ointment, multi vitamin with zinc 200ml (syrup), multi vitamin (zinc+b12+b-comp) drop-30ml, moxifloxacin 0.5%5ml eye drops, moxifloxacin 0.5% 5gm eye ointment , mometasone 1% 15gm (cream), micropore plaster size1.25cm x 9.1mtr 0.5 inch1roll (tissue plaster), micropore plaster size 7.5 cm x 9.1mtr 3inch 1roll(tissue plaster), micropore plaster size 2.5 cm x 9.1 mtr 1inch 1roll (tissue plaster), metronidazole 1.5% w/w -20gm gel, mefenamic acid with paracetamol 50+125mg/5ml 60ml (syp), mct oil 100ml (medium chain triglyceride (mct oil (100ml), luliconazole cream 1%w/v (10gm), liquid paraffin (60ml), lignocaine gel 2% (30gm), lignocaine 10% 50ml (spray), levetiracetam 100mg/ml (syrup), lactulose (200ml syrup), ketokonozol 2%with zinc payrithione 1% (100ml), ketoconazole 2% 20gm (cream), iron and folic acid-30 ml (drops), iron and folic acid (200ml syrup), ipratropium(500.0 mcg) + levosalbutamol / levalbuterol(1.25 mg) 3 ml (respules), hydrogen peroxide solution (100ml) amber bottle wrapped with black thick polybag with printed label 6% w/v, hmf sachet 2gm ( (lactodex hmf nutritional supplement sachet, 2 gm/sachet) sachet, haemocoagulase drops (10ml), glycin irrigation- (3ltr), glycerin-(100ml), glycerin & sodium chloride enema (20ml), glucose-sachets 75gm (dipsi-test), frusemide 10mg (30ml syp), framycetin sulphate 1% 10gm (skin cream), formoterol 6mcg with tiotropium 9mcg mdi 200 metered dose (inhalar), formaldehyde (5ltr), fluticasone propionate 50mcg (nasal spary) 120 meter d

CTN :39739215 Due date: 08 Apr, 202508 Apr, 2025 20.00 Lacs
Tender For nit for the purchase of lab reagents - (n/10) hydrochloride solution (haemoglobin estimation) 500ml, (n/10) hydrochloride solution (haemoglobin estimation) 100ml, haematology test reagent for automated haematology analyzer (3 part) sysmex-kx 21, stromatolyser (3 x 500)ml, stromatolyser (3 x 500)ml, tri level controls (each), cell pack 20 ltr, paper roll (53mm) each roll, pm kit kx 21, calibrator for kx-21, haematology test under microscope, wbc diluting fluid (tlc) 100 ml, total eosinophil count fluid 100 ml, rbc diluting fluid (total blood cell count) 100ml, platelet diluting fluid (platelet count) 100ml, distil water 5 ltr, blood grouping (abo-rh typing)anti abd ( 3 x 10 ml), blood grouping (abo-rh typing)anti- h 10 ml, anti-a1 5 ml, bovine albumin 10 ml, ahg 5ml, jsb stain-i, jsb stain-ii (malaria parasite) 500 ml, jsb stain-i, jsb stain-ii (malaria parasite) 125 ml, copper sulfate 500 gm pack, 3.8% sodium citrate solution (esr) 500 ml, coombs reagent (direct & indirect) (ahg anti c3d monoclonal) 10 ml, coombs reagent (direct & indirect) (ahg anti c3d monoclonal) 5 ml, laboratory stain (giema stain, leishman stain), giema stain 500 ml, leishman stain 500 ml, immersion oil (microscope) 30 ml, occult blood test, rpr card (syphilis)each, hiv rapid (each), hiv elisa method (each), rheumatoid factor (rh typing) 1 x 100 test, aso (each kit), crp (each kit), urine analysis reagent strip (as per packing), multistick (10 parametre) (as per packing), uri stick (2 parametre) (as per packing), pregnancy kit (pack of 100), widal kit (5 x 4 ml) (pack of 100), malaria rapid (each), dengue ns1 and igm combo kit (each), toxoplasma (rapid) (pack of 50), hepatitis b card test (tridot) (pack of 100), hepatitis b elisa method (pack of 50), hepatitis b card test (each card), hepatitis c card test (each card), hepatitis c elisa method (each ), troponin-i (pack of 10), h2s strip (each), biochemistry reagents (fully auto analyzer)erba em-200, blood sugar (lab method) (10x44 ml), blood sugar (glucometer strip) (pack of 100), blood sugar (10 x 44 ml), blood sugar (hexo kinase) each, blood urea (5 x 44 ml), s. creatinine jaffe s kinetic (5 x 44)ml, s. creatinine enzymatic (5 x 30 / 5 x 10 ml, s.bilirubin (t) (6 x 44) ml, s.bilirubin (d) (6 x 44) ml, sgot (6 x 44) ml, sgpt (6 x 44) ml, s.alkaline phosphatase (2 x 44) ml, s.alkaline phosphatase (2 x 22) ml, serum total protein (10 x 44) ml, serum albumin (10 x 44) ml, s. calcium (10 x 12) ml, s. amylase ( 5 x 22) ml, s. uric acid ( 5 x 44) ml, s. cholesterol (10 x 44) ml, s. triglyceride (5 x44) ml, s. triglyceride (5 x 22) ml, ldl-c (direct) (2 x 30) ml, s. hdl (4 x 30) ml, s. lipase (1 x 44) ml, ldh (2x44)ml, s. phosphorus, aso quantitative, crp quantitative, hb aic xl, magnesium estimation kit, serum iron, uibc, ferritin, ck-mb 2.11 ml, micro albumin, micro protein (10 x 12) ml, erba easylite machine (electrolyte), sodium electrode, potassium electrode, chloride electrode, membrane kit, tubing kit, electrolyte pack, electrolyte cleaning solution, internal filling solution, reference electrode, sample detector, wash solution, trilevel controls, other consumables, glass slide (grease free) 50ml (pack of 50), micro tips (yellow/ blue) (each), urine contrainer 50 ml (each), nverta k3 2ml vccume contanier (each), nvedta k2 2ml vccume contanier (each), plain vial vaccume contanier (each), yellow gel tube 4 x 5 ml (or 5ml) (each), sodium citrate tubes vaccume contanier (each), test tube (big) 12 x100 (each), test tube (glass) 18 x 150 (each), test tube (small) 12 x 75 (each), test tube stand (each), test tube holder (each), clotting vial vaccume contanier (each), esr stand (each), esr tube disposable (each), micro pipette(10-200) (each), micro pipette(5-50) (each), micro pipette(10-100) (each), micro pipette(100-1000) (each), tissue paper roll (each), fluoride vial vccume contanier (each), spirit lamp (each), disposable wintrobe tubes for esr (each), capillary tubes (each), cover slips (24 x60 mm) (

State Government

CTN :39372273 Due date: 01 Apr, 202501 Apr, 2025 1.54 Crore
Tender For corrigendum : rate contract for consumable/non-consumables items for microbiology department, rajiv gandhi super speciality hospital, delhi-110093 - dehydrated media, macconkey agarw/o cv, nacl w/ 0 .5% sodium taurocholate(500g/box), brain-heart infusion base(500g/box), blood agar base(500g/box), muller hinton agar base, cation adjusted(500g/box), colistin sulfate salt(1 gram), potassium dichromate(1 kg), peptone powder(500 gram), sulphuric acid(5 ltr), cled (cystein lactose electrolyte deficient)with bromothymol blue indicator(500g/box), peptone (bacteriological) water(500g/box), chromogenic candida agar(500g/box), sabouraud dextrose agar( sda)with chloramphenicol and cycloheximide antibiotics(500g/box), sabouraud dextrose agar( sda)without antibiotics(500g/box), macconkey broth purple with bromocresol purple(500g/box), macconkey broth purple (double strength) w/ bromocresol purple(500g/box), nutrient broth(500g/box), chrom candida differential agar(100 gm), mueller hinton broth with 2 control cations(100 gm), triple sugar iron agar(500gm), simmon s citrate agar(500gm), lab consumables, whatmann filter paper no.1, nichrome loop holderloop holder made of stainless steel rod with heat resistant handle, double wound nichrome loopcalibrated to 1 l, double wound nichrome loopcalibrated to 0.01 ml, double wound nichrome straight wire for inoculation, glassware, frosted end glass slide1. 75mm 25mm 1 mm2. thickness 1.25 0.1mm(1 box=50 slides), glass slide1. 75mm 25mm 2. thickness 1.25 0.1mm(1 packet of 10 grams), cover slip1. 22mmx22mm2. thickness: 0.13mm to 0.16mm(1 packet of 10 grams), test tubes(borosilicate glass) without rim 20mm 150mm, test tubes(borosilicate glass) without rim 12mm 75mm, conical flaskgood quality, flat bottom(500 ml), conical flaskgood quality, flat bottom (1000ml), glass measuring cylinder(100ml capacity), good quality petri dishplastic, disposable, sterile 90 15mm individual packed, glass beaker(500 ml capacity), glass beaker(250 ml capacity), glass measuring cylinder(250ml capacity), glass measuring cylinder(500ml capacity), reagent, carbol fuchsin (ziehl-neelsen)(125ml), 20% h2so4,(500 ml), conc. h2so4(500 ml), acetone(500 ml), crystol violet(25 gram), immersion oil for microscopy(125 ml), potassium hydroxide pellets(500g/box), oxidase discs(50 discs), stained salmonella antigen (to, th, ah, bh) with positive and negative controls for slide agglutination test, lugol s iodine(500 ml), kovac s indole reagent(100 ml), swab, sterile cotton swab with wooden stick1. size 150 x12mm diameter.2. individually packed. , sterile cotton swabs in hdpe tube1. cotton bud with polypropylene stick2. size:150x12mm diameter tubes3. individually packed, sterile swabs1. viscose bud with wooden stick2. size 150 x2.5mm3. individually packed ( gamma sterilized), plasticware, sterile disposable loop1. sterile disposable inoculating loops (4.4 mm diameter calibrated to 0.01ml)2. individually packed, micropipette tips 2-20 l, micropipette tips 20 -200 l, micropipette tips 200-2000 l, elisa plate(50 plates), centrifuge tubes(plastic, 15 ml capacity, screw caped, graduated), microcentrifuge tubeshould be 1.5ml, sterile, polypropylene tube with screw cap.(1.5ml), aerosol barrier tips 2-20 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 20-200 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 100-1000 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., cryovialssterile self standing tight screw cap closures to prevent liquid leakage ,certified rnase/dnase free, human dna free and pyrogen free(2ml), antisera, salmonella polyvalen

CTN :39586620 Due date: 27 Mar, 202527 Mar, 2025 NA
Tender For procurement of lab chemials - oxalic acid , ammonium molybdate , sulphuric acid , nitric acid , hydrochloric acid , sodim nitrate , sodium hydroxide pellets , sodium hydrogen sulphite or sodium bisulphite , silver nitrate , potassium iodide , potassium dichromate , potassium dihydrogen orthophosphate , potassium hydroxide (pellets), potassium hydrogen phthalate , methanol ar , universal indicator , chlorotex reagent , iso-octane , isopropyl alcohol , labolene , conductivity standard solution 147 us/cm , conductivity standard solution 1413 us/cm , conductivity standard solution 12.88 ms/cm , buffer tablets, ph 4.0 , buffer tablets, ph 7.0 , buffer solution ph-4.01 , buffer solution ph-7.00 , buffer solution ph-10.01 , standard for turbidity, 100ntu , water standard solution (210 mg/l) for bod , water standard, celite-545, for tss , hydraver 2reagent, mdi , cod digestion vial- high range , reagent, sulfate , bod nutrient buffer solution pillows , single element aqueous standard iron , single sulphur standard in iso-octane , hydranal water standard 1 cat no 34828

CTN :39573188 Due date: 26 Mar, 202526 Mar, 2025 NA
Tender For supply of vanadium(iv) oxide sulfate hydrate (voso4 xh2o) as per specification , iron (iii) chloride(fecl3) , anhydrous, powder as per specification attached , sodium hydroxide(naoh) , ulttra dry pellets as per specification attached , oxalic acid(ho2cco2h) as per specification attached

CTN :39475182 Due date: 26 Mar, 202526 Mar, 2025 NA
Tender For supply of edl & non edl, eye, x-ray medicines etc - acetazolamide tab.ip 250 mg, iv plasmalyte a 1000 ml (kabilyte), leishman's stain 25gm, levocarnitine 500 mg tablet, lidocaine (xylocaine)hcl 2% inj. 30ml, lidocaine 4% topical, ligaclip mlt 200, linezolid 600 mg tab, metoprolol 1mg/ml 5ml amp.inj., micronised progesterone 200mg tab., micronised progesterone sr 200mg tab, micronised progesterone sr 300mg tab, micronised purified flavonods fraction/ daflon 500 mg tab. (diosmin 450mg + hesperidine 50mg ), minoxidil 2% lotion, montelukast+levocetrizine tab., n - acetyl cysteine ( mucomix) 200mg/ml inj., n- acetylcysteine 600 mg, mucomix)tab, nitrofurantoin tab 100mg tab, non ionic mri contrast media 20 ml, normal saline 1000ml 0.9% i.v, normal saline 3% 100ml i.v, normal saline glass bottle 500 ml iv, ofloxacin400mg tab., pancreatin (cream)10000mg tab., pancuronium (povulon) 2mg/ml inj. 2ml amp., paracetamol 650mg tab., perindopril 8 mg +indapamide 2.5 mg tab., pilocarpine hydrochloride 4% eye drop, pioglitazone 15 mg tab., betamethasone 1mg tab., povidone iodine ointment 500 gm, procainamide 500mg, salbactum 1gm inj., scleral fixated iol (material pmma, optic diameter-6.5mm, overall diameter-6.5mm, equiconvex design, modified c loop haptics, holes in haptics for manipulation), septran (cotrimoxazole) 60 ml syp, septran trimethoprim cotromoxa tab 240 mg, sildenafil citrate 20 mg tab, sildenafil citrate 25 mg tab, silver sulphadiazine cream 250 gm, silver sulphadiazine cream 50 gm, sodium bicarbonate inj., sodium carboxy methyl cellulose eye drop 1% 10ml, sodium valproate 100mg/ml,5ml inj.(valproic acid), sodium valproate control release 500 mg tab, sofosbuvir 400 mg tab, streptokinase 1500000 iu injection, surgical spirit, tab. fluconazole, tadafil 5mg tab., tapentadol 50mg tab., telmisartan 40mg+ amlodipine 5 mg tab., thiopentone sodium 1gm inj., ticagrelor(brillnta) tab 90 mg, bosentan 62.5mg, torsemide 10mg tab., torsemide 20mg/2ml inj, torsemide 5mg tab., torsemide tab. 20mg, triamcinolone[kenacort] 40mg/ml inj., trihexyphenidyl tab 2mg, tropicamide0.8%+ phenylephrine eye drop 5% eye drop, trypan blue 0.15% dye, ursodeoxycholic acid( udiliv) 300mg tab., acyclovir ophthalmic 3% ointment, vancomycin 1g inj., vecuronium inj.5ml vial, verapamil hydrochloride 40mg tab., caffine 40 mg/2ml inj., captopril 25 mg tab, carbamazepine 300 mg tab, carbamazepine scored 200 mg tab, carbimazole 10 mg tab, carbonyl iron with zinc, sulphate &folic acid, carboprost 250mcg/ml inj., ahmed glaucoma valve(glaucoma drainage device), chlorthalidone 12.5 mg tab, cyclosporine preservative free eye drop 0.05%, cylinder trolley large, cylinder trolley medium, dapsone 100 mg tab, dicyclomine + paracetamol tab., digoxin 250 mcg inj., alcaftadine 0.25 % e / d, doxophylline 400 mg tab, d-panthenol gel 5%eye ointment, duloxetine m 20 mg tab, amikacin 500mg inj, esmolol hydrochloride 100mg inj., fenofibrate 145 mg, ferric carboxymaltose 1000 mg/20ml, ferrous sulphate 200 mg tablet, atropine + chloramphenicol + dexamethasone eye drop, flurbiprofen 0.03% eye drop, gliclazide 80mg, glimepride 1mg tab, glimepride 2mg tab, hemodialysis solution part a & b 5 litre, atropine sulfate tab., hepatitis b vaccine immunoglobulin 100 iu, heptagon tab., hydrocortisone inj (effcorlin), hydroxychloroquine 200 mg tab., hydroxyl propyl methyl cellulose 2% preservative free (visco elastic ) 5 ml, inj adalimumab 40 mg, inj aflibercept intravitreal 2mg / 0.05 ml, inj caspofungin 70 mg, insulin aspart 30% and insulin degludec 70% (rdna origin) solution for subcutaneous injection -100iu/ml , 3ml penfill, azelaic acid cream 10%, iris repositor, iron ( ferrous sulphate) and folic acid syp., iron ( ferrous sulphate)+ folic acid tab., iron sucrose 100 mg inj., iron sucrose 50mg inj., isi marked sodium hypochloride solution, iso amyl 2-cyanoacrylate glue, isotonic balanced crystalloid solution with calcium acetate and malate (sterofundin iso 500 ml ), isotretinoin 10 mg cap.,
 Loading, Please wait...

Connect us via What's Up