Latest sterile Tenders | Government sterile Tenders

Central Government/Public Sector

CTN :39848376

09 Apr, 2025 NA

Jaipur - Rajasthan

Tender For supply of yankur's suction set sterile disposable

Central Government / Public Sector

CTN :39848423

07 Apr, 2025 NA

Nanded - Maharashtra

Tender For supply of ned_medical_(phno.:31121) i.v. sets sterile disposable non vented

Central Government/Public Sector

CTN :39848997

08 Apr, 2025 NA

Delhi - Delhi

Tender For supply of (2025-26 ami code-28u 026) jelly lignocaine 2% w/v 30gm tube water soluble sterile packed.

Central Government/Public Sector

CTN :39849154

15 Apr, 2025 NA

Jaipur - Rajasthan

Tender For supply of disposable sterile cautery pencil compatable for covidine machine

Central Government/Public Sector

CTN :39849252

16 Apr, 2025 NA

Delhi - Delhi

Tender For supply of ami no.gr39n08/24-25) sterile polyhexam

CTN :39846983

17 Apr, 2025 NA

Belgaum - Karnataka

Tender For supply of chlordiazepoxide 10mg tab , doxepin 25 mg cap , clomipramine hcl 25 mg tab , clozapine 100 mg tab , duloxetine 20 mg tab , doxepin hcl 75 mg cap , fluoxetine hcl 20 mg cap , haloperidol 5 mg tab , lorazepam 1 mg tab , lithium carbonate 300 mg cap tab , clonazepam 0 point 25 mg tab , clozapine 25 mg tab , desvenlafaxine 50 mg tab , etizolam 0 point 5 mg tab , risperidone 2 mg tab , aripiprazole 10 mg tab , atomoxetime 10 mg tab , olanzapine 10 mg tab , venlafaxine 75 mg tab , sertraline 50 mg tab , zolpidem 10 mg tab , quetiapine 50 mg tab , paroxetine xr 12 point 5 tab , tab amisulpride 200 mg , quetiapine 25 mg tab , sertraline 100 mg tab , glycopyrronium 25 mcg smartules , etophylline bp 84 point 7mg theophylline 25 point 3 per ml 2 ml inj , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per cfc free mdi , cap nintedanib 150 mg , cap nintedanib 100 mg , levosalbutamol sulphate 2 point 5 ml containing 1 point 25 mg respule , tiotropium bromide 9 mcg 120 metered doses unit inhaler , tiotropium bromide 18 mcg formoterol 12 mcg dry powder cap , budesonide 200 mcg dry powder , formoterol 12 mcg fluticasone 250 mcg dry powder , tiotropium bromide 18 mcg dry powder cap , terbutaline 1 point 25 mg bromhexine 4 mg guaiphenesin 50 mg per 5 ml bott 100 ml syp , dextrose 5 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , sterile water for amp of 10 ml , tab cap mirabegron 25 mg , silodosin 4 mg tab , anti phlebitis cream tube of 15g 20g , povidone iodine 10 percent solution bott of 100 ml , enteral feed pdr protein 85 peptides 15 fat 50 mct 25 85 15 50 25 percent sachet 126 gm , cilostazole tab 100 mg , sildenafil citrate 50 mg tab , tolteridone tartrate 2 mg tab , drotaverine hcl 40 mg tab , finasteride 5 mg tab , vitamin b complex vit b1 5mg vit b6 3mg vit b12 5mcg therapeutic tabcap , vitamin b 12 500 mcg ml inj , iron syp paediatric 5 ml elemental iron 25 50 mg folic acid 500mcg bottle of 200ml , multi vit inj iv thiamine 30mgml pyridoxine 30mg ml cyanocobalamin 300 mcgml 2 to 10ml , dapaglifozin 5 mg tab , fluticasone propionate inhaler for adults 125 mcg dose , salmetrol 50mcg fluticasone 250mcg pdr 30 60 100 doses pdr inhaler , colchicine 0 point 5mg tab , capsacain gel tube of 20 gm , glucosamine 250mg chondroitin sulphate 200 mg cap , ibuprofen gel tube of 20 gm , leflunomide 10 mg tab , nimesulide gel tube of 20 gm , methylprednisolone 4 mg tab , clindamycin 300 mg cap , sulphamethoxazole 400 mg trimethoprim 80mg tab , acyclovir 200 mg tab , emtricitabine 200 mg tenofovir 300mg tab , lamivudine 150 mg tab , efavirenz 600 mg tab , zidovudine tab 300 mg , zidovudine 300mg lamivudine 150mg nevirapine 200mg tab , nitrofurantoin 100 mg cap , clozapine 50 mg tab , bisoprolol 2 point 5mg tab , carvedilol 6 point 25 mg tab , olmesartan 20 mg tab , propanolol 10 mg tab , trimetazidine mr 35 mg tab , gliclazide 40 mg tab , voglibose 0 pont 3 mg tab , tab ornidazole 500 mg , tenofovir 300 emtricitabine 200mg efavirenz 600mg tab , hepatitis b vaccine 10 ml , cell culture rabies vaccine vial of 1 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml , syp iron with vitamin b12 and folic acid bott of 200 ml , syp lactulose each 5ml containing 3 point 325g bott of 200ml , syp liquid paraffin 1 pont 25 magnesium hcl 3 point 75 sodium picosulphate 200 ml bott , syp multivitamin multiminerals bott of 200 ml bid details/ 2 / 72

CTN :39847214

26 Apr, 2025 NA

Delhi - Delhi

Tender For supply of aneurysm clip permanent 5 mm straight , aneurysm clip permanent 5 mm bayonet , aneurysm clip permanent 5 mm curved , aneurysm clip permanent 5 mm fenestrated , aneurysm clip permanent 6point5 mm straight , aneurysm clip permanent 6point5 mm bayonet , aneurysm clip permanent 6point5 mm curved , aneurysm clip permanent 6point5 mm fenestrated , aneurysm clip permanent 7 mm straight , aneurysm clip permanent 7 mm curved , aneurysm clip permanent 7 mm fenestrated , aneurysm clip permanent 7 mm bayonet , aneurysm clip permanent 8 mm straight , aneurysm clip permanent 8 mm fenestrated , aneurysm clip permanent 8 mm curved , aneurysm clip permanent 8 mm bayonet , vicryl no 1 half circle round body needle 36 mm suture 120cm , vicryl no1 half circle cutting needle 36 mm suture 120cm , mersilk no 1 cutting needle half circle 40 mm 90 cm , mersilk no3 0 round body needle 12to16 mm 90 cm , fibrin sealent with synthetic aprotinin 2 ml kit , fibrin sealent with synthetic aprotinin 4 ml kit , spongostan gelatine sponge size 7cm x5cm x 1cm , spongostan gelatine sponge 7cm x5cm x point5cm , wraparound surgical gown w size xl , wraparound surgical gown size large , vaccum suction drain size 14 , compressed rayon patties thin 20x40mm box of 20 , compress rayon patties thin radio opaque marker 20x20mm box of 20 , compressed rayon patties thin 20x30mm box of 20 , compressrayon pattiesthick radio opaque marker20x50inch boxof 20 , nylon no 2 0 half circle cutting needle45mm 100cm , suction yankauer rosebud tip vacuum control 3 m , opsite dressing for post op wounds 25 x 10 cm , opsite dressing for post op wounds 15point5 x 8point5cm , disposable surgical sterile ot drape size large 150x200cm , disposable surgical sterile ot drape size medium 120x150cm , dressing wound care 10cm x 10cm box of 5 , dressing wound care 20cm x 20cm box of 3 , polyaxial pedicle screws 4point5 x 30 mm nut titanium , polyaxial pedicle screws 4point5 x 35 mm nut titanium , polyaxial pedicle screws 4point5 x 40 mm nut titanium , polyaxial pedicle screws 4point5 x 45 mm nut titanium , polyaxial pedicle screws 4point5 x 50 mm nut titanium , polyaxial pedicle screws 5point5 x 30 mm nut titanium , polyaxial pedicle screws 5point5 x 35 mm nut titanium , polyaxial pedicle screws 5point5 x 40 mm nuttitanium , polyaxial pedicle screws 5point5 x 45 mm nut titanium , polyaxial pedicle screws 5point5 x 50 mm nut titanium , rod for pedicle screw dia 5point5 mm or 6 mm compatible with procured screw , peek vertebral cervical spacer prefilled 5 mm sterile , peek vertebral cervical spacer prefilled 6 mm sterile , peek vertebral cervical spacer prefilled 7 mm sterile , peek vertebral cervical spacer prefilled 8 mm sterile , disp perforator with duraguard 14 mm , surgicel nuknit 3x4 box of 24 foils , disp perforator with duraguard 09 mm , disposable craniotomy drape kit bid details/ 2 / 47

Central Government/Public Sector

CTN :39847416

07 Apr, 2025 NA

Katni - Madhya Pradesh

Tender For supply of sterile hypodermic syringe (v3) (q2)

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39835248

16 Apr, 2025 3.95 Lacs

Kamrup - Assam

Tender For supply of dglp gem 52 - balanced salt solution bss for intracameral use 500ml , capsular tension ring with fixation arm , sterile powder free latex gloves size 7 dot 5 ansell , halogen photo optic bulb 6v 20w slit lamp bulb , sterile disposable double eye drape pouch 68 into 68 cm , disposable trolley cover for eye surgery , fluoresceine sodium eye strips 0 dot 1 percent 100 strips pkt , eye slash ear buds pkt of 100 , fibrin glue for glude iol , pupil expansion ring b hex , schirmer tear test strip , sterile disposable double eye drape pouch 70 into 100 cm

Sterile Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government / Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector