Latest sulphur Tenders | Government sulphur Tenders

CTN :39842132

29 Mar, 2025 NA

Villupuram - Tamil Nadu

Tender For insurance premium sugar stock at mill site godown,molasses stock, sulphur stock, empty gunny stock

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

Central Government/Public Sector

CTN :39846650

11 Apr, 2025 NA

Burnpur - West Bengal

Tender For providing of custom bid for services - replacement of tubes of the esp boilers(sulphur condenser boiler and process gas cooler boiler)

CTN :39846983

17 Apr, 2025 NA

Belgaum - Karnataka

Tender For supply of drug and medicine - chlordiazepoxide 10mg tab , doxepin 25 mg cap , clomipramine hcl 25 mg tab , clozapine 100 mg tab , duloxetine 20 mg tab , doxepin hcl 75 mg cap , fluoxetine hcl 20 mg cap , haloperidol 5 mg tab , lorazepam 1 mg tab , lithium carbonate 300 mg cap tab , clonazepam 0 point 25 mg tab , clozapine 25 mg tab , desvenlafaxine 50 mg tab , etizolam 0 point 5 mg tab , risperidone 2 mg tab , aripiprazole 10 mg tab , atomoxetime 10 mg tab , olanzapine 10 mg tab , venlafaxine 75 mg tab , sertraline 50 mg tab , zolpidem 10 mg tab , quetiapine 50 mg tab , paroxetine xr 12 point 5 tab , tab amisulpride 200 mg , quetiapine 25 mg tab , sertraline 100 mg tab , glycopyrronium 25 mcg smartules , etophylline bp 84 point 7mg theophylline 25 point 3 per ml 2 ml inj , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per cfc free mdi , cap nintedanib 150 mg , cap nintedanib 100 mg , levosalbutamol sulphate 2 point 5 ml containing 1 point 25 mg respule , tiotropium bromide 9 mcg 120 metered doses unit inhaler , tiotropium bromide 18 mcg formoterol 12 mcg dry powder cap , budesonide 200 mcg dry powder , formoterol 12 mcg fluticasone 250 mcg dry powder , tiotropium bromide 18 mcg dry powder cap , terbutaline 1 point 25 mg bromhexine 4 mg guaiphenesin 50 mg per 5 ml bott 100 ml syp , dextrose 5 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , sterile water for amp of 10 ml , tab cap mirabegron 25 mg , silodosin 4 mg tab , anti phlebitis cream tube of 15g 20g , povidone iodine 10 percent solution bott of 100 ml , enteral feed pdr protein 85 peptides 15 fat 50 mct 25 85 15 50 25 percent sachet 126 gm , cilostazole tab 100 mg , sildenafil citrate 50 mg tab , tolteridone tartrate 2 mg tab , drotaverine hcl 40 mg tab , finasteride 5 mg tab , vitamin b complex vit b1 5mg vit b6 3mg vit b12 5mcg therapeutic tabcap , vitamin b 12 500 mcg ml inj , iron syp paediatric 5 ml elemental iron 25 50 mg folic acid 500mcg bottle of 200ml , multi vit inj iv thiamine 30mgml pyridoxine 30mg ml cyanocobalamin 300 mcgml 2 to 10ml , dapaglifozin 5 mg tab , fluticasone propionate inhaler for adults 125 mcg dose , salmetrol 50mcg fluticasone 250mcg pdr 30 60 100 doses pdr inhaler , colchicine 0 point 5mg tab , capsacain gel tube of 20 gm , glucosamine 250mg chondroitin sulphate 200 mg cap , ibuprofen gel tube of 20 gm , leflunomide 10 mg tab , nimesulide gel tube of 20 gm , methylprednisolone 4 mg tab , clindamycin 300 mg cap , sulphamethoxazole 400 mg trimethoprim 80mg tab , acyclovir 200 mg tab , emtricitabine 200 mg tenofovir 300mg tab , lamivudine 150 mg tab , efavirenz 600 mg tab , zidovudine tab 300 mg , zidovudine 300mg lamivudine 150mg nevirapine 200mg tab , nitrofurantoin 100 mg cap , clozapine 50 mg tab , bisoprolol 2 point 5mg tab , carvedilol 6 point 25 mg tab , olmesartan 20 mg tab , propanolol 10 mg tab , trimetazidine mr 35 mg tab , gliclazide 40 mg tab , voglibose 0 pont 3 mg tab , tab ornidazole 500 mg , tenofovir 300 emtricitabine 200mg efavirenz 600mg tab , hepatitis b vaccine 10 ml , cell culture rabies vaccine vial of 1 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml , syp iron with vitamin b12 and folic acid bott of 200 ml , syp lactulose each 5ml containing 3 point 325g bott of 200ml , syp liquid paraffin 1 pont 25 magnesium hcl 3 point 75 sodium picosulphate 200 ml bott , syp multivitamin multiminerals bott of 200 ml

CTN :39804397

31 Mar, 2025 NA

Ponnani - Kerala

Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39826349

31 Mar, 2025 NA

Bangalore - Karnataka

Tender For supply of low sulphur high speed desiel oil

State Government

CTN :39832169

28 Mar, 2025 64.02 Lacs

Diu - Daman And Diu

Tender For 2nd call of procurement of sports equipments for 1st khelo india beach games, 2025 - beach kabaddi, official whistlestandard, beach kabaddi warning cardsgreen, red. yellow, arm bands red- 05, yellow 10, pink 10, blue - 05, beach kabaddi field marking tapepvc (men s court : width 3 to 5 cm & length 44m, colour: blue & red) & (women s court width 3 to 5 cm & length 44m, colour: blue & red) ,with 10 anchoring plates for extra stability, beach kabaddi digital score board standard, stop watchesdigital with 100% accuracy; time stop watch and digital clock, 30 second hooterstandard, match over/half time hooterstandard, 3rd raid flakart standard, weigh scalestandard, table stop & go clockstandard, measuring tape lightweight freeman top line 100 meter with 13mm width., beach mallakhamb, mallakhamb pole sheesham or rosewood pole,height 3.2 meter, top 7 cm ,neck : 18 to 20 cm, diameter bottom 53 to 55 cmapproved by mfi, rajal powder , caster oil, magnesium carbonate powder box of 1 kg per box total 10 kg, napkinsstandard, wire rope standard, rope mallakhamblength 21 feet thickness 20 mm, approved by mfi, mallakhamb mat 1 mtr x 2 mtr x 60mm thickness, hanging mallakhamb with chain sheesham or rosewood pole,height 1700-1900 mm, neck height 180-200,bottom width:450 to 500, mm approved by mfi, mallakhamb crash mat3 mtr x 2 mtr x 300mm thicknessfoam with rrexin cover standard, powder stand 3 feet stand with tub, beach tug of war, tug of war ropelength: 33.5 m width: 30mmapproved by twfi, referee whistlestandard, stop watch approved by sfi, ribbon/ pvc tape 5 meter each, colour: white, green, red & blue, ground marking length: 30meter, 4 cotton white nivar, weight machine commercial, beack pencak silat, chest guardsone sided of black color of small , medium, large and xl made of pu heavy quality with poly u-foam high density filling & having pvc tubing & back will be on cotton living., black uniform with different color sash like white and orangecloth of black tricot with double stitching and with 2 logos on the chest ( cotton made ), white uniform with different yellow color sash cloth of white tricot with double stitching and with 2 logos on the chest, inter lock mats thickness 40 mm of 1x1 meter as per the specification , matt finish, double color, ( made of rubber- eva foam ), groin guardsdifferent sizes ( both male and females), arm guardssmall medium and large, score sheetprinted book, shin guard paireva foam, sports googlesev ray, red & blue signalplastic board, gong and strikermade of metal and wood made, red & blue flag (30 0f each colour)only use for manual scoringplastic pipe with color flag with one ft/one ft with games logo, weapon standwood or steel, stopwatchstandard, weighing machinecommercial, whistlestandard, wooden clapper standard, measuring tape freeman 100meter., beach soccer, beach soccer ballsize 5 soccer balls (footballs) have a diameter of 8.6 -9 (22-23 cm) and circumference of 27 -28 (68-70 cm). the mass of a size 5 soccer ball is between 14-16 oz (400-450 g) with a pressure between 8.5-15.6 psi (58.6-107.6 kpa).specifications: its size is 5 it is water resistant its outer material is made of rubber, core bladder is made up of synthetic rubber it weighs 400 g it is suitable for grass and artificial turfapproved by aiff, goal net clipsnet clips, u type nail clipsu shape iron clip, bibsfeatures: mesh material light construction loose cut kiug-2022 logo on the front, photographer bibsofficial photographer polyester tabards.this polyester tabard is not ppe (personal protection equipment)one size only.these lightweight adults colored polyester tabards are suitable for a wide range of uses include photographers, volunteers, team sports, charity fundraising events and general usage, but they are not suitable for safety environments requiring visibility safety clothing.kiug-2022 logo on back side, bibs for ball boys & stretchers bearers mesh material - light construction - loos

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39836956

17 Apr, 2025 NA

Jodhpur - Rajasthan

Tender For supply of abrasive steel shots size - s460.as per is : 4606/1983 (saej827/j444). chemical analysi s carbon: 0.60-1.20 %, silicon: min. 0.40%, phosphorus/ sulphur: max. 0.05% av. hardness- 40-50 hr c, min density - 7.3 gm/cu.cm. as per drg.no. n/a specn: is: 4606/1983(saej827/j444) [ warranty p eriod: 30 months after the date of delivery ]

Sulphur Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector

State Government

Central Government/Public Sector

Central Government/Public Sector