Thiobarbituric Acid Tenders

Get complete information related to latest Thiobarbituric Acid Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Thiobarbituric Acid Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Thiobarbituric Acid Tenders .

Filter

Loading....

Get Tender in Email

CTN :39976295

23 Apr, 2025 NA

Bhubaneswar - Odisha

Tender For procurement of consumable parts for beckman coulter au chemistryan:alyzers for the department of biochemistry on pac basis ataiims, bhubaneswar - albumin , alt , ast , alk phos ifcc , amylase ifcc , urea / bun , total bilirubin , direct bilirubin , calcium arsenazo , cholesterol , ck-mb , ck-nac , creatinine , glucose hexokinase , ggt , hdl cholesterol , ldl cholesterol , lactate , lipase , ldh ifcc , magnesium , phosphorous , triglyceride , total protein , iron , uibc , uric acid , urinary csf protein , apo a1 , ??? ? , ceruloplasmin , crp (normal application) , crp (high sensitive application) , rf latex , aso, haptoglobin , c3 , c4 , immunoglobulin a , immunoglobulin g , immunoglobulin m , prealbumin , transferrin , a-1 antitrypsin , b-2 microglobulin , hba1c , microalbumin , d-dimer , a-1 acidglycoprotein , carbama?????? , digitoxin , digoxin , gentamycin , paracetamol , phenobarbital , phenytoin , theophyllin , valproic acid , amphetamines/ecstasy , barbiturates , benzodiazepines , cocaine , eddp , methadone , opiates , thc, ise buffer , ise mid standard , ise reference , ise std high + low urine , ise serum std high , ise serum std low , ise selectivity check , ise internal reference , na electrode , k electrode , cl electrode , ref electrode, urine calbrator , system calibrator , hdl-cholesterol, calibrator , ldl-cholesterol calibrator , ck-mb calibrator , apo a1&b calibrator , serum protein multi calibrator , crp latex calibrator normal set , crp latex calibrrator highly , sensitivity set , rf latex calibrator , serum protein multi calibrator , prealbumin calibrator , hbaic calibrator , microalbumin calibrator , d-dimer calibrator , multi calibrator core tdm , digitoxin (tdm calibrator) , digoxin calibrator , multi calibrator antibiotic tdm , wash solution , cleaning solution weekly wash , cleaning solution (contamination avoidance) , hemoglobin denaturant , control serum level 1 , control serum level 2 , ck-mb control serum level 1 , ck-mb control serum level 2 , hdl/ldl cholesterol control , ita control serum level 1 , ita control serum level 2 , ita control serum level 3 , crp latex control serum (high s , hba1c control, , d-dimer control , , negative calibrator dau , multi drug primary , multi drug secondary , multi drug intermediate , multi drug high , methadone cut off , methadone intermediate , methadone high , thc 25 , thc 50 , thc 75 , thc 100 , multidrug controls , speciality controls , thc 25 controls , thc 50 controls

CTN :39946718

28 Apr, 2025 NA

Wardha - Maharashtra

Tender For supply of alcohol methyl , aluminium foils , bioclean , blood sedimentation pipette from 0_200 mm in 1 mm , cover slip , diluents for cbc machine can of 20 ltr , distilled water can of 5 ltr , glucometer strip accucheck , ketodiastix bott of 50 strips , leishman stain bott of 500ml , lyse for cbc machine can of 10 ltr , marking pen , microtips 0_100 ul , micro tips 100_1000 ul , micro tips 50_200 ul , plastic test tube , test tube plain with clot activator , serum haemagglutnating gp a anti-b monoclonal , serum haemagglutnating gp b anti_a monoclonal , serum heamaglutinating gp o anti-ab monoclonal , slide microscope thickness 1point15 to 1point35mm size 75mm x 25mm , spirit bott of 500 ml , strips albumin and glucose bottle of 100 strips , urine container disposable , albumin test kit of 250ml , amylase test kit , alkaline phosphatase test kit of 36ml , kit for estimation of bilirubin , calcium estimation kit , crp c_reactive protein kit of 50 test , kit for estimation of cholestrol , kit for estimation of triglyceride , kit for estimation of creatinine , kit for estimation of glucose , kit for estimation of hdl , kit for estimation of uric acid , typhidot igm igg kit , kit for estimation of urea , dengue ns1 igg igm test kit , pregnancy test kit , ra factior kit , sgot ast test kit of 100ml , sgpt alt test kit of 100ml , esr disposable piptte , filter paper , vaccum blood collection tube edta 2ml 3ml , vaccum blood collection tube sodium floride , vaccum blood collection tube without gel sterile 5ml , widal test kit , hbs ag rapid kit , hiv i and ii rapid test kit , total protein test kit of 250ml , potassium estimation kit , rapid card screening for hbv , rapid card screening for hcv , sodium estimation kit , vdrl test kit , serum haemaglutinating anti d rh monoclonal , stool for occult blood , sickling rapid test , vaccume needle holder , vaccum needle , malaria rapid , blood componant filter bid details/ 2 / 49

CTN :39926584

28 Apr, 2025 NA

Silvassa - Gujarat

Tender For supply of laboratory materials - thermal printer roll for analyzer , ldl cholesterol cartridge , urea nitrogen cartridge , absorbance test cartridge , ahdl calibrator , albumin cartridge , aldl calibrator , alpl calibrator , alkaline phosphatse cartridge , amylase cartridge , c reactive protein cartridge , calcium cartridge , chem i calibrator , chem ii calibrator , chol calibrator , cholesterol cartridge , ck cartridge , ck mb cartridge , cki mbi calibrator , creatinine cartridge , cuvette cartridge , direct bilirubin cartridge , enzyme calibrator , glucose cartri , hb a1c cartridge glycated haemoglobin , psendo cholinestrase calibrator , pseudocholinesterase cartridge , rcrp calibrator , sample cups , sgot cartridge , sgpt cartridge , total bilirubin cartridge , total protein cartridge , triglycerides cartridge , uric acid cartridge , tbi-dbi calibrator , tp-alb calibrator , dca system for dca vantage hba1c , hdl cholestrol cartridge , biochemistry control level 1 , biochemistry control level 2 , iron cartridge 240 test , urinecsf protein cartridge 80 test , iron tibc , ucfp calibrator 10 , empty cartridge 8 flex , enzyme ii calibrator , free t4 - loci 120 test , tsh - loci 200 test , free t3 - loci 120 test , thyroid calibrator , vit b12 - loci , anemia cal , vitamin d kit , vitamin d calibrator , lactate dehydrogenase , sample probe cleaner , reagent probe cleaner , chemistry wash , hm vessels , hcg cartridge 120 test , hcg calibrator , adazyme for ada , adazyme control level 1 , d dimer turbo kit , d dimer turbo control , g 6pd qualitativea , barium cholride solution 500ml , capillary tube , cleanac , cleanac 3 , esbatchs albuminometer , disposable tip , hemolynac 310 , hemolynac 3n , isotonac 3 , slide washing solution , tissue paper roll size 10 cm , urine stool sputum container , uristitix 12 para , uristix 10 para , uristix 10 para control , uristix 3 para protein , uniplastin system pack , vaccutte empty heparin soduim , vacute na citrate , liquceline e system pack , methyline blue stain 500ml , whatmans filter paper , reticulocyte stain , plasmatrol h1 , plasmatrol h2 , uristix 2 para suger , vacute edta , vacute plain , plain blood collection tube , medipoint , methanol 500ml , micropippette 5 to 50 , distilled water 5 ltr , may grunwald giemsa , coombs antisera antihuman globulin , bovine serum albumin , sulphuric acid h2so4 , methyleted spirit ip , alchol spirit , match box , lable for sputum cups , diamond glass marker pen , lance cleaning papers books , whatmans filter paper 125cm , auto pipette 10 to 1000 , auto pipette stand , pap smear kit , cedar wood oil , reaction cup for hemostar-auto , matrix diluent , hemostar 4cr wash solution , slide keeping box , broom stick , dpx mounting , sol.formalin , hematology controls , matrix ahg card , leishmans stain 500 ml , nebaucer chember , calibrator for 3 part cell counter , plastic bottle wide mouth screw cap , wbc diluting fluid bottle , potassium hydrogen phosphate , sodium phosphate monobasic dihydrate , staining racks . , droppers . , blood group , test tubes holder , beaker , glacial acetic acid , benedict reagent ready , na nitroprusside crystal , liquor ammonia , ammonium sulphate crystal , hay sulphur powder , litmus paper , sternal puncture needle adult size , liver biopsy needle , museum jars with glass lid and glass plate , staining jars for slides , urinometers , graduated cylinders of , graduated cylinders , reagents bottles

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Thiobarbituric Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector