Web Analytics Made Easy - StatCounter

Thiobarbituric Acid Tenders

Get complete information related to latest Thiobarbituric Acid Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Thiobarbituric Acid Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Thiobarbituric Acid Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :40033398 Due date: 08 May, 202508 May, 2025 NA
Tender For supply of media chemicals and antibiotics for dept of micro biology at aiims bhopal - rare disease medicine, aesculin, agar agar powder, bacterioides bile esculin agar base, bird seed agar, blood agar base no.2, bovine serum albumin (bsa), brain heart infusion agar base, brain heart infusion broth base dehydrated, brucella agar base with hemin & vitamin k1, canavanine glycine bromothymol blue agar/cryptococcus differential agar dehydrated, chrom agar for isolation and identification of candida species., citrate agar, simmons, cled agar dehydrated, corn meal agar dehydrated, crome agar cromogenic group b streptococcus selective agar base, czapekdox agar dehydrated, dermatophyte test medium agar base dehydrated, dichloran rose bengal chloramphenicol yeast extract sucrose agar dehydrated, egg yolk agar base, hichrom agar m1297a, indole nitrate broth base, macconkey agar w/o cv, macconkey broth double strength dehydrated, malt extract agar dehydrated (meat), mannitol salt agar dehydrated, manniton motility test medium, moeller decarboxylase broth base, mueller hinton agar dehydrated, mueller hinton broth, cation adjusted, nitrate broth dehydrated, nutrient agar, oatmeal agar, potato dextose agar, propionibacter isolation agar, pyr agar, robertson cooked meat medium rcm, rpmi 1640 with glutamine & without sodium bicarbonate, w/o phenol red, sabourauds dextrose agar/sabourauds dextrose agar emmons modification dehydrated, sabourauds dextrose broth dehydrated, selenite f broth, sheep blood, sucrose powder, todd hewitt broth, tri sodium citrate, trihalose powder, triple sugar iron agar (tsi) dehydrated, tryptone soya agar, tryptone type 1, urea 40% supplement, yeast extract powder, yeast one broth (10x11ml), -naphthylamine readymade solution, acetic acid aldehyde free (acetone), acetone, agarose powder (molecular grade), aluminium ammonium sulfate, ammonia solution, andrades indicattor (1001), anerobic catalyst low tempreture (a00010 x 5), antisera for salmonella vi, aqueous solution of picric acid (saturated), autoclave indicator tape steam, b. fragilis atcc 25285, bacteroides selective supplement fd062-5vl, basic fuchsin, biological indicator for autoclave (la926-1x50no) geobacillus stearothermophilus scbis", biological indicatore hot air oven bacills atrophascus, bromothymol blue, buffer capsule ph 4.0, buffer capsule ph 7.0, buffer capsule ph 9.2, calcium chloride anhydrous, calcofluor white (liquid stain ready to use approx 100 ml), capreomycin sulfate cat. sigma c4142, carbol fuchsin, cc selective supplement fd010-5vl, citric acid, coagulase plasma, crystal violet, d- (+) glucose anhydrous, d-(-)-salicin, d-mannitol (mannitol sugar disc), demineralized water, di-potassium hydrogen phosphate anhydrous, diethyl ether ar grade, dmaca reagent (pyr reagent), dmso, dna ladder (100bp), dpx mountant, dulcitol sugar disk, egg yolk infusion, ethanol absolute (analytical grade), ferric ammonium sulphate, formaldehyde (40%), formalin solution, galactose sugar disk, galactose sugar powder, gas pack le0028-5no (anaero gas pack) 5x1nos, gelatin, giemsa powder, glacial acetic acid, glassware cleaning reagent, glucose sugar disk, glycerol (anhydrous emplura), hand rub / sanitizer, hand wash liquid soap, hematoxylin powder, hydrochloric acid (conc.), hydrogen peroxide 30% h2o2, hypochlorite (5%) / sodium hypochlorite 5%, immersion oil, india ink/nigrosine, inositol sugar disk, iodine crystals, iodine gram stain (gram iodine), kovacs indole reagent (indole : p-dimethyl benzaldehyde), l- arginine, l- ornithine hcl broth m688, l+ arabinose, lactophenol cotton blue (approx 100 ml) ready to use, lactose sugar, lycine hcl broth, lysol, magnesium sulphate anhydrous, malachite green, maltose, mannitol sugar powder, mcfarland standard set, methanol purified ar grade (hi-lr), methylene blue, modified zn stain, n-acetyl-l-cysteine, neutral red dye (indicator), neutral red powder, normal saline plain, nuclease free water, oleic acid, paraffin sterile

CTN :40004718 Due date: 03 May, 202503 May, 2025 12.44 Lacs
Tender For supply of paracetamol with cysteine hcl monohydrate infusion 1000 mg per 100ml , adrenaline tatrate inj 1 in 1000 1ml amp , dexamethasone sodium phosphate 4.4 mg equivalent to dexamethasone phosphate 4 mg per ml 2 ml inj , inj lorazepam 2 mg per ml 2 ml , co trimoxazole suphamethoxazole 400 mg trimethoprim 160 mg tab , clotrimazole mouth paint 1percentage bott of 15 ml , paraffin 15 ml containing magnesium hydroxide 11.25 ml and liq paraffin 3.75ml , isosorbide dinitrate 10 mg tab , isosorbide 5 mononitrate 20 mg tab , propranolol tr 40 mg tab , oint benzoyl peroxide 5percentage tube of 20 gms , calamine powder , clindamycin phosphate 1 percentage topical gel tube of 10 gm , chlorhexidine gluconate solution equivalent to 4 percentage with isopropanol ethoxylated alkylphenol fatty acid diethanolamidec acetic acid 500ml bott dispenser , 2 propanol 45gm 1 propanol 30gm ethyl hexadecyl dimethyl ammonium ethyl sulphate 0.2gm with skin protecting substances 500 ml bott with dispenser , chloroxylenol solution potassium hydroxide 13.6g chloroxylenol solution 50.5g oleic acid 7.5ml castor oil 63g terpineal 100ml ethanol 96 percent 200ml purified water , frusemide 20 mg 2 ml inj , ranitidine hcl 50 mg 2 ml inj , dicyclomine hcl 20mg inj , enema sodium phosphate ml 6 percent sod acid phosphate 16 percent pack of 100 m , glycerine suppositories child size 2g mould , bisacodyl 5 mg tab , betahistdine dihydro chloride 8mg tab , nasl decongestant adult drops xylometazoline hcl 0.1percent bott of 10 ml , alprazolam 0.25 mg tab , ipratropium bromide respirator soln 500mcg per 2ml respule , codeine phosphate 10mg chlorpheneramine maleate ip 4mg per 5ml bottle of 100 ml sugar free syp , syp terbutaline sulphate1.25mg bromhexine hcl 4 mg guaphenesin 50 mg per 5 ml bot of 100 ml , sterile water for amp of 10 ml , inj b 12 500 mcg per ml , glucosamine 250 mg chondroitin sulphate 200 mg cap , ceftriaxone 1gm inj , syp cefuroxime susp 125mg per 5ml bott of 30 ml , tetanustoxoid purified absorbed rubber cap vial of 5 ml 10 dose , common cold tab antihistiminics paracetamol 500 mg without pseudoephedrine , cough lozenges dextromethorphan , clinidipine 10mg , hydrochlorothiazide 12.5mg tab , rosuvastatin 10 mg tab , montelukast 10 mg tab , syp multivitamin with zinc minerals biotin and selenium 100ml bottle , telmisartan 80mg tab , acenocoumarol 2 mg tab

CTN :39920637 Due date: 25 Apr, 202525 Apr, 2025 7.90 Lacs
Tender For supply of inj dobutamine 12.5 mg , mefenemic acid 250 mg plus dicyclomine hydrochloride 10 mg tab , quinine 300mg tab , levodopa 125 mg tab , topiramate 50mg tab , ethamsylate 250 mg tab , rivaroxaban 20 mg tab , mannitol 20 percent 100 ml bottle , benzocaine 20 percent pectin based oral ointment tube of 5 gm , triamcinalone acetonide 0.1 per for oral use tube of 5gm , cream silver sulphadiazine 1percent w v jar of 500 gms , triamcilone 10 mg inj , lignocaine 2.5 percent plus prilocaine 2.5 percent tube of 30gm , ear drop para dichlorobenzene 2 percent wv benzocaine 2.7 w v chlorbutol 5 percent turpentine oil 15 percent w v bott of 10ml clear wax , povidone iodine 7.5 percent solution 100 ml , 2 propanol 45 percent w w 1 propanol 30 percent w w ethyl hexadecyl dimethyl ammonium ethylsulphate mecetronium ethyl sulfate 0.2 percent w w bott of 500 ml brand bactorub blue raman and well , chloroxylenol solution potassium hydroxide 13.6 g chloroxynol soln 50.5g oleic acid 7.5ml castor oil 63.0g terpineal 100ml ethanol 96 pernt 200ml to rwc not les thn 3 dettol

CTN :39881270 Due date: 21 Apr, 202521 Apr, 2025 37.84 Lacs
Tender For supply of drugs and pharamceutical products - e ifa re 03 collagen peptide 40mg sod hyluru 30mg chondrotin tab , e ifa re 03 colostomy bag with flange and clip size 60mm with deodorant charcol chamber , e ifa re 03 colostomy bag with flenge 50mm , e ifa re 03 cough lozenges , e ifa re 03 cream fluocinolone acetonide 20 gm tube , e ifa re 03 creatinine test , e ifa re 03 liquid paraffin 1 dot 25mg magnesium hydroxide 3 dot 75mg sodium picosulphate 3 dot 3mg 170ml syp , e ifa re 03 crp kit span , e ifa re 03 cudcee forte tab prebiotic and probiotic capsules , e ifa re 03 cyclophosphomide 50 mg tab , e ifa re 03 cyclosporin 50 mg tab , e ifa re 03 cyproheptadine 4 mg tab , e ifa re 03 daflon 500mg diosmin 450mg hesperidin 50mg tab , e ifa re 03 danazole 200mg tab , e ifa re 03 dapagliflozin 10 mg metformin 500 mg tab , e ifa re 03 dapagliflozin 5 linagliptin 10 mg tab , e ifa re 03 darifenacin 7 dot 5 mg tab , e ifa re 03 deca peptide lotion , e ifa re 03 deflazacort 30mg tab , e ifa re 03 delivery system for salmeterol fluticasone rotacaps with pin puncture , e ifa re 03 dengue test igg and igm , e ifa re 03 dental gel , e ifa re 03 desensitising paste stannous fluoride potassium nitrate sod monofluorophosphate tube of 50gm , e ifa re 03 desidustat 50mg tab , e ifa re 03 desvenlafaxine 50 mg tab , e ifa re 03 chloroxylenol sol pot hydroxide 13 dot 6g chloroxylenol solution 50 dot 5g oleic acid 7 dot 5ml castor oil 63 dot 0g terpineal 100ml ethanol 96 100 ml dettol 100 ml bottle , e ifa re 03 chloroxylenol sol pot hydroxide 13 dot 6g chloroxylenol solution 50 dot 5g oleic acid 7 dot 5ml castor oil 63 dot 0g terpineal 500ml ethanol 96 100 ml dettol 500 ml bottle , e ifa re 03 dexamethasone 0 dot 5mg tab , e ifa re 03 diacerein 50 mg tab , e ifa re 03 diclofenac paracetamol serratiopeptidase tab , e ifa re 03 diclofenac 100 mg metaxalone 400 mg tab , e ifa re 03 diclofenac 50 mg serratiopeptidase 10 mg tab , e ifa re 03 diclofenac spray bottle of 40 gm , e ifa re 03 dicyclomin 10 mg tab , e ifa re 03 dicyclomine drops of 15 ml syp , e ifa re 03 dienogest 2mg , e ifa re 03 diethylcarbamazine 50 mg tab , e ifa re 03 diltiazem 60 mg tab , e ifa re 03 dimethyl fumarate 240 mg tacfidera cap , e ifa re 03 diosmin hesperidin 1000 daflon tab , e ifa re 03 disodium hydrogen citrate syrup , e ifa re 03 disposable diagnostic cartridge eg7 box of 25 , e ifa re 03 disposable insulin pen needles 4mm , e ifa re 03 distilled water , e ifa re 03 disulfiram 250 mg tab , e ifa re 03 divalproex 250 mg tab , e ifa re 03 divalproex 500 mg tab , e ifa re 03 divalproex sodium cr 500 mg tab , e ifa re 03 dns fluid bid details/ 2 / 46

CTN :39846918 Due date: 17 Apr, 202517 Apr, 2025 14.57 Lacs
Tender For supply of drug and medicine - adapalene 0 point 1 percent tube of 15 gm , tacrolimus oint 0 point 03 percent 20 gm tube , benzoyl peroxide 2 point 5 percent tube of 20 gm tube , calamine lotion 50 ml tube , betamethasone dipropionate 0 point 05mg gentamycin sulphate 1mg tube of 5gm , zinc oxide titanium dioxide bott 50 sunscreen lotion bottle of 60 ml , clindamycin phosphate 1 percent topical gel tube of 10 gm , clobetasol propionate cream 0 point 05 percent in tube of 10 gm , desonide 0 point 05 percent bott of 30 ml , fluticasone 0 point 05 percent w per w cream 10gm tube , liquor formaldehyde 40 percent w v , framycetin sulphate cream bp 1 percent cream 20 gms , ketoconazole lotion 2 percent bott of 75ml , isotretinoin 20 mg cap , metronidazole 1 percent tube of 30gm , permethrin 5 percent tube of 30 gm , lotion terbinafine 1 percent 20 ml , terbinafine 1 percent cream tube of 10 gm , tretinoin 0 point 05 percent tube of 20 gm , hydroxyzine hcl 25mgtab , fusidic acid cream 2 percent w per w 10g tube , paradhichlorobenzene 2 percent benzocaine percent chorbutol 5 percent turpentine oil 15 percent ear drop clear wax , sodium hypochlorite 5 percent , 10 percent povidone iodine solution 1 percent iodine 500 ml bott , chloroxylenol hydroxide 13 point 6g chloroxylenol solution 50 point 5g oleic acid 7 point 5ml castor oil 63 point 0g terpineal 100ml ethanol 96 percent 200ml , chlorhexidine chlorhexidine gluconate7point 5 percent cetrimide bp 15 percent 500 ml bott , povidone iodine solution 5 percent bottle of 100 ml , acetazolamide 0 pouint 25g tab , tab dutasteride 0 point5 mg , cilnidipine 5 mg tab , frusemide 40 mg tab , frusemide 20 mg 2 ml inj , eplerenone 25 mg tab , spironolactone 50 mg tab , rifaximin 550mg cap ,frusemide 40 mg amiloride hydrochloride 5 mg tab , pancreatic enzyme supplement lipase content of 25000 units cap , antispasmodic containing mefenamic acid 250 mg dicyclomine hcl 10 mg , tab levosulpiride 25 mg , tab entacavir 0 point 5 mg , antacid chewable aioh 3 300mg mg silicate 25 mg simethicone 25 mg , trypsin and chymotrypsin 6 ratio 1 100000 au enteric coated tab , ranitidine hcl 50 mg 2 ml inj , metoclopramide 10 mg tab , metoclopramide hcl 5mg ml 2ml inj , dicyclomine 20 mg paracetamol 500 mg tab , dicyclomine hcl 20mg inj , drotaverine hcl 20 mg per ml inj , hyoscine bromide inj 20 mg per ml 1ml inj , mebeverine hcl 135mg tab , isapgol ispaghula husk 3 point 5 gm , bisacodyl 5 mg tab , parraffin liq in bottle of 100 ml , pancreatic enzyme cap lipase content of 10000 to 20000 units , loperamide 2mg tab , pantoprazole 40 mg domperidone sr 30 mg cap , pantoprazole 40 mg levosulpride 75 mg cap , rifaximine 400 mg tab , ethinyl estradiol 0 point 035mg cyproterone acetate 2mg pack of 21 tablets , oestrogen cream concentration 0 point 06 percent to 0 point 1 percent tube of 15 to 50 gms , clotrimazole vaginal pessary 100mg , levonorgestrel 0 point 25 mg ethinylestradiol 0 point 03mg pack of 21 tab , nor ethisterone 5mg tab , gliclazide mr 30 mg tab , glipizide 5mg tab , glibenclamide 5mg tab , sitagliptin 50 mg metformin 1000mg tab , linagliptin 2 point 5 mg metformin 500 mg , pioglitazone hydrochloride 15 mg tab , carbimazole 5 mg tab , alendronate sodium 70mg tab , pyridostigmine 60 mg tab , calcium acetate 500 mg tab , protein supplement for predialysis renal failure , sevelamer 400 mg tab , betaxolol eye drops 0 point 25 percent 0 point 5 percent bott of 5 ml , chloramphenicol 0 point 5 percent dexamethasone sodium 0 point 1 percent bott of 5 ml , ciprofloxacin hcl 0 point 3 percent dexamethasone 0 point 1 percent bott of 5ml , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , gentamicin sulphate 0 point 3 percent gentamicin base with hydrocortisone acetate ip 1 percent eye ear drops bott of 5 ml , ketorolac tromethamine 0 point 4 percent eye drops , brimonidine tartrate 0 point 2 percent eye drops , methyl cellullose 2 percent solution bottle of 5 ml , ofloxacin 0 point 3 percent bott of 5 ml , luli

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
 Loading, Please wait...

Connect us via What's Up