Latest transmission fluid Tenders | Government transmission fluid Tenders

corporations/Associations/Others

CTN :40033980

24 Apr, 2025 4.71 Lacs

Delhi - Delhi

Tender For procurement of reagents and chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi - supply of reagents & chemicals of testing stp treated water samples in water quality monitoring unit, vinay marg, chanakyapuri, new delhi.ammonium chloride (500 gm), tri-ammonium citrate (500 gm), ammonium ferrous sulphate (500 gm), ammonium buffer solution (500 gm), boric acid ar (500 gm), bromocresol green soln. (125 ml), calcium chloride fused (500 gm), carbon tetrachioride(500 gm), di-potassium hydrogen ortho phosphate (500 gm), dithizone (5 gm), ethyl acetate (500 ml), ferric chloride (500 gm), ferrous sulphate crystalline (500 gm), haxane ar (500 ml), hydrochloric acid (500 ml), lead nitrate (500 gm), macconkey broth (500 gm), silver nitrate n/50 solution (500 ml), mercuric oxide(red/yellow) (100 gm), mercuric sulphate (250 gm), methyl red indicator soln.(125 ml), nitric acid (500 ml), methyl blue indicator alkaline (125 ml), paraffin wax 58-60 & 60-62 (500 gm), petroleum ether(bp 40-60c) (500 ml), phenol crystal(500 gm), phenolpthalen indicator solution (125 ml), 1.10 phenanthroline monohydrate (ferroin indicator) (5 gm), potassium dichromate ar(500 gm), potassium lodate(250 gm), potassium lodide(250 gm), potassium nitrate anhydrous ar(500 gm), potassium permanganate(500 gm), potassium sulphate (500 gm), silver sulphate(25 gm), sod.azide(100 gm), sodium chloride(500 gm), sodium meta bisulphite(500 gm), sodium nitrate(100 gm), sod.sulphite(500 gm), sod.thiosulphate(500 gm), sodium hydrogen phosphate(500 gm), stannous chloride(250 gm), sulphamic acid(500 gm), thymol blue indicator soln. (pack of 125 ml), edta n/50solution (500 ml)

CTN :40025203

06 May, 2025 NA

Mumbai - Maharashtra

Tender For supply of laboratory chemicals - aniline , acetic acid glacial ch3cooh toxic 500ml , xylene cap 2.5lt , isooctane ch3 3cch2ch ch3 2 540 84 1 50 , karl fischer reagent with , methanol dried sply 500 ml each , petroleum benzine 40 60 , petroleum benzine 60 80 , so propyl alcoho sply 5.0 lt can , poly ethylene glycol cap 230kg drum , diethyl ether sply 500 ml each , ammonium acetate , carbon disulfide , 1 butanol c4h10o c4h9oh cap 2.5lt bottl , sodium hydroxide , toluene cap 2.5lt , 2 propanol sply 2.5 lt each , mercuric sulfate hgso4 7783359 non flamm , 1 2 dimethoxyethane sply 1 lt each , 1 10 phenanthroline c12h8n2 cas 66 71 7 , 2 hexanone , silica gel 100 200 , iodine solution sply 3 amp pack each , sulfuric acid h2so4 7664939 non flammabl , univ indicator soln ph 4 11 sply 500 ml , toluene c6h5ch3 flammable 5l dr

State Government

CTN :40025276

06 May, 2025 18.00 Lacs

Delhi - Delhi

Tender For supply of gapdh antibody rabbit , hepes buffer , dmg peg 2000 , electrophoresis power supply , electrophoresis apparatus , centrifuge tips autoclavable 10 ul , centrifuge tips autoclavable 200 ul , centrifuge tips autoclavable 1000 ul , storage glass bottle autoclavable 100 ml , storage glass bottle autoclavable 500 ml , storage glass bottle autoclavable 1000 ml , microfuge stands , microtube rack , conical tube racks , measuring cylinders 100 ml , measuring cylinders 500 ml , measuring cylinders 1000 ml , filtering membrane 0.22 micron , filtering membrane 0.45 micron , spray bottle , tissue rolls , autocolavable plastic bags , glass beakers 50 ml 100 ml , glass conical flasks 100 ml 200 ml 500 ml , antibiotic antimitotic solution , gloves , vacuum pump and discard apparatus , membrane filter holder 47mm , hemocytometer , disposable pipettes 1ml , disposable pipettes 2 ml , disposable pipettes 5 ml , disposable pipettes 10 ml , polyethersulfone membrane pore size 0.2 um , polyethersulfone membrane pore size 0.45 um , microcentrifuge tipbox , micropipette p10 1-10 ul , micropipette p20 2-20 ul , micropipette p200 20-200 ul , micropipette p1000 100-1000 ul , micropipette 0.5-10 ul , prestained protein ladder , multicolor low range protein ladder 250 ul , 8 channel multi channel pipette , glass pipettes 2 ml , glass pipettes 1 ml , glass pipettes 5ml , glass pipettes 10 ml , glass pipettes 0.1 ml , glass pipettes 0.2 ml , temed -ar grade , ficoll hypaque density gradient media -ar grade , formaldehyde -ar grade , cotton roll , petroleum ether -ar grade , n- butanol -ar grade , isopropanol -ar grade , agarose medium eeo -ar grade , glacial acetic acid -ar grade , methanol -ar grade , acetic acid aldehyde free -ar grade , ethanol -ar grade , sucrose - ar grade , butter paper sheets , tris-hcl , ether , methanol , acetyl acetone , sodium dodecyl sulfate , cryogenic tube with screw cap , cryo gloves , cryogenic boxes racks , cryogenic mini cooler , edta , acrylamide , bis acrylamide , ammonium per sulphate , lab spatula , precision weighing balance , pipet tips for gel loading

Central Government/Public Sector

CTN :39697545

25 Apr, 2025 NA

Solapur - Maharashtra

Tender For corrigendum : supply of chemicals - natural colour 10000 ul capacity la888 1 x 100no 1 x 100no , freezing bo x es cardboard dim 13.4 x 13.4 x 4.7cm 64 place freezing bo x 2 inch cg289 1 x 10no 1 x 10no , freeze tag white label size 25 x 13 mm 1000 labels pack roll form la938w 1 x 1000no 1 x 1000no , hiindicator ph paper la310 1pk 1pk , cryogenic permanent marker red dual point la697 1no 1no , cryogenic permanent marker black dual point la697a 1no 1no , hicap b18 blue coloured 18 mm od pw024 500no 1 no , hicap b38 blue coloured 38 mm od pw032 500no 1 no , triclogel in 5 lit can pack co155 1no 1 no , hi pette autopipette stand made with acrylic sheet 9 pipette holding capacity with tip bo x la632 1no 1 no , pikovskayas broth medium granulated gm1719 500g 500gm , aleksandrow broth m1997 500g 500gm , zinc solubilizing medium m2023 500g 500gm , 100bp dna ladder mbt049 200ln 200ln 4 x 200 ul , 2 x pcr taq mi x ture mbt061 100r 100r 2.5 ml , 50 x tae ml016 500ml 2 x 500 ml , syringe driven filters sf144 2 x 50no 2 x 50 no. , syringe driven filters sf143 2 x 50no 2 x 50 no. , petroleum ether 60 to 80 degree c hi ar as065 2.5l 2.5 liter , quantitative filter paper 0740 1250 100c , freeze tag la940w 1 x 1000no , l proline pct0317 25g 25 gm , polygalacturonic acid rm4779 5g 5 gm , orthophosphoric acid abt 88 percent hi ar as011 500ml 500 ml , hydrochloric acid abt 35 percent pure hi ar as004 2.5l 2.5 liter , ferrous ammonium sulphate he x ahydrate hi ar acs grm3887 500g 500 gm , potassium dihydrogen phosphate for hplc grm2951 250g 250 gm , diphenylamine hi ar acs grm520 250g 250 gm , paraffin liquid heavy grm6362 500ml 500 ml , paclobutrazol pct0828 25g 25 gm , buffer solution ph 4.0 plus or minus 0.02 ml061 500ml 500 ml , buffer solution ph 7.0 plus or minus 0.02 ml062 500ml 500 ml , buffer solution ph 9.2 plus or minus 0.02 ml063 500ml 500 ml , starch soluble hi ar acs grm3029 500g 500g , gluten hydrolysate maize rm6406 500g 500g , pectin grm396 500g 500g , guar gum powder grm1233 500g 500g , glycerol 85 percent as100 1l 1l , tween 80 lq520 x 25 x 10ml 25 x 10ml , gelatin type a mb169 500g 500gm , 2 4 6 tri2 pyridyl s triazine rm1487 1g 1 g , ferric chloride anhydrous tc583 5g 5 g , 2 2 diphenyl 1 picrylhydrazyl rm2798 1g 1 g , chitosan from shrimp shells grm9358 100g 100 g , sodium borohydride hi ar acs grm10345 100g 100 g , phenol reagent hi lr rm10822 100ml 100 ml , clear ph buffer solutions 480 ml bottleph 4.01 ecbu4bt 480 ml , clear ph buffer solutions 480 ml bottleph 7.00 ecbu7bt 480 ml , clear ph buffer solutions 480 ml bottleph 9.00 ecbu9bt 480 ml , hiindicator ph paper la335 1pk 1 pk , nutrient broth m002 500g 500 g , potato de x trose broth granulated gm403 500g 500 g , agar powder bacteriological grade grm026p 500g 500 g , autoclavable petri plates pw008 1 x 100no 1 x 100no , freeze tag la939w 1 x 1000no 1 x 1000no , parafilm d m250 la017 1no 1 no , s.s test tube racks la222 1no 1 no , hiclean liquid soap as023 5l 5 l , hidispo bag 14 pw038 250no 250 nos. , syringe driven filters pvdf hydrophilic membrane pore size 0.22 um 25 mm diameter with prefilter non sterile sf130 1 x 250no 1no. , sulfuric acid pure hi ar as016 500ml 500 ml , perchloric acid about 70 percent hi ar acs as013 500ml 500 ml , sodium hydro x ide pellets hi ar acs grm467 500g 500 g , methanol hi ar as059 2.5l 2.5 l , hydrochloric acid abt.35 percent pure hi ar as004 500ml 500 ml , citric acid anhydrous mb174 500g 500 g , amylase from malt grm638 500g 500 g , nutrient agar bid details/ 2 / 103 medium mm012 500g 500 g , potato de x trose agar mh096 500g 500 g , lactobacillus mrs agar mrs agar m641 100g 100 g , phytawrap pla002 1 x 10no 10 no , hi fle x iloop 2 pw012 5 x 100no 5 100no , mueller hinton agar m173 500g 500 g , potassium carbonate anhydrous hi ar grm731 500g 500 g , sodium benzoate hi ar grm1260 500g 500 g , sodium starch glycolate hi lr grm7519 500g 500 g , acetone hi ar as025 500ml 500ml , 0.1 percent peptone water lq172c 5 x 100ml 5 100ml , tric

CTN :39970993

30 Apr, 2025 NA

Leh - Jammu And Kashmir

Tender For supply of engine oil 15w40 , engine oil sj 5w30 , heavy duty diesel engine oil kb 30 , gear oil 80w90 , transmission fluid a , hydraulic oil hlp 32 , hydraulic oil hlp 46 , hydraulic oil hlp 68 , hydraulic oil th 46 , grease rr3 , grease wb , kool plus coolant , brake fluid dot 4 , transmission oil t 20 , therm medium plant oil , electra welding transformer oil , def ad blue for other v or e or ps , def ad blue for ashok leyland dumper or tippers , starting aid capsule sac

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Transmission Fluid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

corporations/Associations/Others

State Government

Central Government/Public Sector

State Government

Central Government/Public Sector