Latest water level indicator spares Tenders | Government water level indicator spares Tenders

CTN :41066150

28 Oct, 2025 55.68 Lacs

Delhi - Delhi

Tender For bid to ras bid to ras supply of laboratory consumables e e - hydrogen phosphate, 500 gms , potassium phosphate monobasic, 500gms , ammonium persulphate, molecular biology reagent, 100 gms , fetal bovine serum, 500 ml , dmem low glucose, without sodium pyruvate, phenol red, 500 ml , acrylamide or bis acrylamide, 30percent, 100 gms , ripa buffer, 50ml , ficoll histopaque, 500 ml , bca protein estimation solution sigma, 1 liter , rat st2 elisa kit, 96 t , nitro blue tetrazolium chloride, 1 gms , lipopolysaccharide lps solution 500x, 100 ul , protease inhibitor cocktail 100 x, 5 ml , penicillin streptomycin, 100 ml , dextran, fluorescein, greater than 500000g permol, 250 gms , rat cd 11b fitc labelled antibody for flow cytometry , rat cd68 pe labelled antibody for flow cytometry , cd16 antibody, 100 ul , akinetic tubridometric assay kit for serum endotoxin detectionm, 96t , pe anti rat cd8a antibody, 100 ul , foxp3 monoclonal antibody fjk 16s, apc, 100 ug , ror gamma t, monoclonal antibody afkjs 9, pe, 100 ug , human t bet, alexa fluro 594 conjugated antibody , rat cd4 monoclonal antibody fitc, 200 ug , sybr green i nucleic acid gel stain, 0.5 ml , cdna synthesis kit, 200 rxns , phusion high fidelity pcr kit, 100rxn , isolation rna kit, 100 reactions , total antioxidant capacity colorimetric assay kit, 96 t , lactate dehydrogenase ldh activity assay kit, 96 t , acetic acid, 100 ml , rat d lactic acid elisa kit, 96 test , dmso for cell culture, 100 ml , sodium azide, 50 gms , western blot developer chemiliminscent substrate milipore, 2 x 25 ml , rat cd8 pe labelled antibody for flow cytometry, 25 ug , cd86 b7 of 2 monoclonal antibody gl1, pe, 100ug , cd206 monoclonal antibody mr5d3, fitc, 100ug , jam a cd321 polyclonal antibody, 100 ug , rat il13 interleukin 13 elisa kit, 96t , human myeloperoxidase elisa kit, 96 t , dithiothreitol, 100 gms , n formyl methionyl leucyl phenylalanine fmlp , l citrulline, 500 mg , sodium citrate dihydrate, 500 gms , rat maresin 1 elisa kit, 96 test , temed electrophoresis grade, greater or equal 99percent, 50 ml , rat defensin beta 2 elisa kit, 96 test , rat cathelicidin antimicrobial peptide elisa kit, 96 wells , rat mcp1 or ccl2 elisa kit, 96 wells , rat ccl4 or mip 1 beta elisa kit, 96 wells , rat cxcl 15 elisa kit, 96 wells , rat mig monokine induced by interferon gamma elisa kit, 96 test , rat ip10 interferon gamma induced protein 10kda elisa kit, 96 test , rat blc 1 b lymphocyte chemoattractant 1 elisa kit, 96 wells , rat sdf1 or cxcl 12, stromal cell derived factor 1 elisa kit, 96 test , sytox green nucleic acid stain, 5mm solution in dmso , cox 2 antibody , rat pge2 prostaglandin e2 elisa kit, 96 test rat elisa kit interleukin 6, rat elisa kit for tumor necrosis factor alpha, rat macrophage inflammatory protein-1, mip1a elisa kit, rat elisa kit for interleukin 1 beta, rat elisa kit interferon gamma, rat elisa kit transforming growth factor beta, rat elisa kit interleukin 10, rat interleukin 17, il-17 elisa kit, rat elisa kit for monocyte chemotactic protein 1, lix/cxcl5 rat elisa kit, tarc/ccl17 human elisa kit, rat mdc/ccl22 (macrophage derived chemokine) elisa kit, rat interleukin 18, il-18 elisa kit, rat interleukin 33, il-33 elisa kit, rat il-18 elisa kit, 96 test detection range 2pg/ml-600pg/ml, mouse tnf alpha elisa kit, mouse il-1beta elisa kit, mouse interleukin 6 (il-6) elisa kit, rat intestinal fatty acid binding protein elisa kit, rat zonulin elisa kit, rat lipid binding protein elisa kit, alexa fluor 564 anti rabbit secondary antibody, goat anti-rabbit igg (h+l) fluor 488 conjugated antibody, inos polyclonal antibody 100ul, nf-kb p65 antibody, zo-1 antibody, 100ul, phospho-tirap (tyr106) antibody, 100ul, //bid details 2 / 85

Central Government/Public Sector

CTN :42457358

17 Nov, 2025 NA

Kozhikode - Kerala

Tender For supply of hpaii,mspi,bsai hf r v2 1000 units,t4 polynucleotide kinase 500 units,t4 dna ligase 20000 units,monarchr spin plasmid miniprep kit 50 preps,monarchr genomic dna purification kit 50 preps,monarchr spin rna isolation kit 50 preps,m0667t engenr spy cas9 hf1 500 pmol,e3322s engenr sgrna synthesis kit s pyogenes 20 reactions,t2040s monarchr spin rna cleanup kit 10 preps,m0689s neb authenticaser 25 reactions,e3321s engenr mutation detection kit 25 reactions,e2040s hiscriber t7 high yield rna synthesis kit 50 reactions,make neb monarchr spin rna cleanup kit 10 preps,t7 endonuclease i 250 units,engenr sgrna synthesis kit s pyogenes 10 reactions,engenr mutation detection kit 25 reactions,bsai hfr v2 1000 units,t4 dna ligase 20000 units

Central Government/Public Sector

CTN :42306399

05 Nov, 2025 21.34 Lacs

Bhimtal - Uttarakhand

Tender For supply of component hrp membrane substrate , 3 3 diaminobenzidine , ammonium persulfate , cobalt ii chloride , yepd broth granulated 500g , ypd yepd growth agar 500g , ypd yepd growth medium , yeast nitrogen base ynb w ammonium sulphate 100g , peptone 500g , yeast extract powder , l histidine , dextrose anhydrous hi ar acs , l glutamic acid , l methionine , l lysine hi lr , l leucine , l isoleucine , 10x tris glycine sds gel running buffer , 2 5x tris sds buffer ph 8 8 , 5x tris sds buffer ph 6 8 , 10x transfer buffer , 5x laemmli buffer , 50x tae , rna isolation , sedgewick rafter counting chamber cell , borosilicate bod bottles , borosilicate dissolved oxygen bottles , uniflo 13mm 0 2 pes s 100 pk , uniflo 13mm 0 45 pes s 100 pk , uniflo 25mm 0 45 pes s 45 pk , uniflo 25mm 0 2 pes s 45 pk , single tubes pcr 0 2 ml transparent with attached flat cap , microcentrifuge tubes pp 0 5 ml with attached cap with lid closure , microcentrifuge tubes pp 1 5 ml with attached cap with lid closure , microcentrifuge tubes pp 2 0 ml with attached cap with lid closure , microcentrifuge tubes pp 5 ml transparent , mueller hinton agar granulated 500g , mueller hinton broth 500g , glucose yeast extract agar 500g , glucose yeast extract acetate broth 500g , agar granulated bacteriological grade 500g , nutrient agar granulated , nutrient broth granulated , d glucose anhydrous , sodium chloride , xylene for histopathology 2 5l , resazurin sodium salt 5g , z 2 cl osu 100g , mtt 1g , n phenyl 1 naphthylamine 500g , propidium iodide , wizard genomic dna purification kit 100 isolations x 300ul , wizard sv gel and pcr cleanup system 50 prep , hepes molecular biology grade free acid 100g , disc3 5 3 3 dipropylthiadicarbocyanine iodide 100mg , petridish , centrifuge tube conical bottom with lid , self standing centrifuge tube with lid , cryovial with external threaded self standing sterile , cryo box pp , rack for micro tube l , rack for micro tube , universal tube rack pp , universal tube rack , 20c mini cooler with gel filled cover , 0c mini cooler with nontoxic gel , agar powder bacteriological grade , mueller hinton agar , mueller hinton broth , tryptone soya broth soyabean casein digest medium , tryptone soya agar casein soyabean digest agar soyabean casein digest agar , steriswift disinfectant wipes , polyethylene glycol mw 6000 , sterile cotton swab , 2 10ul aerosol barrier gentip , 20 200ul aerosol barrier gentip , 100 1000ul aerosol barrier gentip , wrappup alluminium foils , biosoft tissue , kimwipes , kimberly clark , ecosafe disinfectant , centrifuge tube , petri dish , syringe

State Government

CTN :42267843

03 Nov, 2025 2.50 Lacs

Delhi - Delhi

Tender For supply of bakers yeast , sodium pyruvate , sucrose , tris , bsa , mgcl2 , naoh , agar , ether , cotton , rna isolation kit , diethylpyrocarbonate depc , dual luciferase reporter assay kit , glacial acetic acid , acetone , catechol , bromine , carbon tetrachloride , stoppered conical flask 250 ml , rnaase inhibitor , dnaase , tlc plates , tlc chamber glass , amino acids reference standard kit , tris-hcl , methanol , standard protein marker broad range , butanol , petroleum ether , nh4cl , hcl , ficoll hypaque density gradient media , nahco3 , ethanol , beetroot borer , pcr teaching kit , southern blotting kit , diastase , cholestrol estimation kit , lb agar , penicillin , grams iodine , widal test kit , 3,5- dintrosalicyclic acid , mtt , passive agglutination , double immunodiffusion , single radial immunodiffusion , dot blot elisa , t 4 estmation kit , estmation of urea , estmation of uric acid , sgot and sgpt , serum creatinine. , restriction digestion kit , competent cells preparation kit , blue white screening transformation kit , nickel affinity chromatography kit , microtips 100-1000ul , microtips 2- 200ul , teepol , tissue roll , glass cuvette 3.5ml , glass cuvette 1ml , quartz cuvette 1ml , measuring glass cylinders 100ml , glass pipettes 1ml , glass pipettes 2ml , glass pipettes 5ml , glass pipettes 10ml , falcon tubes 15ml , beakers 100ml , beakers 250ml , beakers 500ml , beakers 1000ml , mannitol salt agar , emb agar , macconkey agar , bacterial identification kit himedia kb016 , bacterial identification kit himedia kb013 , bacterial identification kit himedia kb004 , chloroform , china dish , glass beads small

Central Government/Public Sector

CTN :42270203

03 Nov, 2025 16.98 Lacs

Bhimtal - Uttarakhand

Tender For supply of custom dna synthesis of primers 25 nmol , prime script 1st strand cdna synthesis kit 50 reactions , tb green pre mix ex taq ii tli rnase h plus , rnaiso plus total rna extraction reagent , amylase from bacillus licheniforms , amyloglucosidase from aspergillus niger lyophilized powder 70 u mg , glucose oxidase form aspergillus niger type vii lyophilized powder 100000 units g solid without added oxygen , peroxidase from horseradish type ii essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol , primers forward revers total base 1249 , fish immunoglobulin m ig elisa kit 96t , superoxide dismutase sod elisa kit , fish lysozyme renal amyloidosis lzm elisa kit , fish interleukin 6 il 6 elisa kit , fish cortisol elisa kit , forward primers , reverse primer , taq dna polymerase , ezassay antioxidant activity estimation kit cuprac 200 tests , azo m protein azo casein , ezdetect pcr kit for mycoplasma detection based on 16s 23s rrna spacer region , trypsin inhibitor powder source soyabean cell culture tested activity 7000baee units of inhibition mg , coif1 5tcaaccaaccacaagacattggcac3 26 nucleotides , coir1 5tagacttctgggtgccaaagaatca3 26 nucleotides , m151 5aacccggctttcggcagca3 20 nucleotides , m152 5cggggcggggttgtgagat3 20 nucleotides , ihn up f 5agagatccctacaccagagac 3 21 nucleotides , ihn up r 5agagatccctacacagagac 3 21 nucleotides , vn f 5atggaaggaggaatcgtgaagcg 3 24 nucleotides , vn r 5 gcggtgaagtgctcagttccc 3 22 nucleotides , ipn f 5 gtgctggccacaacgacaac 3 21 nucleotides , ipn r 5 aattggtctgccgttccta 3 19 nucleotides , isaoic f 5 ggctatctaccat aacgaat 3 21 nucleotides , isaoic r 5 gccaagtgtaagtgcactcc 3 21 nucleotides , bench top 1kb dna ladder , bench top 100bp dna ladder , bench top pcr marker , taq dna polymerase recombinant 5u ul , quick cip 1000 units with buffer , t4 dna ligase 20000 units , protoscript ii first strand cdna synthesis kit 30 reactions , q5 high fidelity 2x master mix 100 reactions , onetaq 2x master mix with standard buffer 100 reactions , synthetic peptides , spectradrop 24 kit , easy yeast plasmid isolation kit 50 rxns , quick easy yeast transformation mix 20rxn , western blot immuno booster pf 250ml , western blot blocking buffer protein free 500ml , fastdigest apai 300rxn , fastdigest bamhi 800rxn , fastdigest bgiii 100rxn , fastdigest ecori 800rxn , fastdigest ecorv eco32i 200 rxn , fastdigest hindiii 800rxn , fastdigest kpni 300rxn , fastdigest ncoi 20rxn , fastdigest ndel 100 rxn , fastdigest nhel 50 rxn , fastdigest notl 50 rxn , fastdigest saii 200rxn , fastdigest smai 100 rxn , fastdigest saci 100 rxn , fastdigest xbai 300 rxn , fastdigest xhoi 400 rxn , fastdigest value pack , synthetic peptide , mrgsh 011fw , mrgsh 011rv , shrv 1 f , shrv 1 r , shrv 2 f , shrv 2 r , shrv ipc2 fwd , shrv ipc2 rev , bacterial genome sequencing

Central Government/Public Sector

CTN :42228337

31 Oct, 2025 6.22 Lacs

Hazaribag - Jharkhand

Tender For supply of sodium azide mb grade , silver nitrate 0 1 n solution , sodium chloride , sodium molybdate dihydrate , sodium nitrite mb grade , sodium sulphate anhydrous , 3 m sodium acetate ph 5 2 mb grade , sodium dihydrogen phosphate dihydrate , sodium hydroxide , sodium carbonate anhydrous acs 99 9 minimum purity , sodium diethyldithiocarbamate trihydrate acs minimum purity 99 , sucrose pure , sulfuric acid pure hi ar , sulphanilamide hi ar , 5 sulphosalicylic acid 3 , sulfosalicylic acid dihydrate extra pure , 2 3 5 triphenyl tetrazolium chloride , 2 thiobarbituricacidtba extrapurear 99 , 40x tae buffer hi grade , 10x tbe buffer , 5x t4 dna ligase buffer , tembotrione metabolite , tetracyclin , thiourea extra pure ar , titanium dioxide , titanium chloride , toluene lr grade , tris buffer , tris hcl buffer , trizol reagent 200 ml , tris base mb grade 1 kg , tris hcl ph 8 0 1m 1000ml , triethanolaminepure 98 , trichloroacetic acid tca , triton x 100 , uridine diphosphoglucose , 2 vinylpyridine , whatman filter paper no 1 , yeast invertase , yeats hexokinase , yeast p glucose isomerase , zinc sulphate , zinc sulfate heptahydrate , dna isolation kit from plant , first strand cdna synthesis kit verso , genejet gel extraction kit , gsure rna isolation kit from pigeon pea , g9 taq dna polymerase 10x buffer with mgcl2 5u l , pcr master mix 2x , one step rt pcr kit , hi efficiency ta cloning kit , purelink rna mini kit , rapid dna ligation kit , surespin plasmid mini kit , super dh5alpha comp cell , taq dna pol 3u l including 10x buffer 25mm mgcl2 , g9 taq dna polymerase 10x buffer with mgcl2 5u ul , t4 dna ligase , trackit 100 bp dna ladder

Central Government/Public Sector

CTN :42211196

30 Oct, 2025 NA

Izatnagar - Uttar Pradesh

Tender For supply of real time pcr machine : :-- real time pcr , one data analysis system with i5 processer , 3kva online ups , rna isolation kit 300 rxn , evagreen kit 300 rxn , fast multiplex pcr kit 300 rxn , realtime pcr plate-96 , pcr sealer , pcr strip and cap for 1000 rxns

Water Level Indicator Spares Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

State Government

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector