Latest water proofing material Tenders | Government water proofing material Tenders

CTN :39278116

01 Apr, 2025 3.02 Lacs

Rajauri - Jammu And Kashmir

Tender For bid to ras tender for supply of thiopentone inj of 0.5 g without water for injection , bupivacaine hcl inj 5mg/ml heavy amp of 4 ml , lignocaine hcl inj 2%(without adrenaline) vial of 30ml(suitable for ophthalmic use also) , lignocaine hcl 2% with adrenaline(1 0000) vial of 30 ml inj , lidocaine/lignocaine hcl 2% with adrenaline/elinephrine (1 80 000) 1.8ml catrdige , lignocaine 100 mg & ethanol 28 mg/ml v/v spray container of 500/800 md , atropine sulphate 0.6mg in 1 ml amp , iso-propanol 60-65% and benzalkonium chloride skin disinfectant , 63gm/0.025 gm in 100 gm , 1 , 6 dihydroxy , 2-5 dioxahexane , gluteraldeyde benzylalkonium chl , alkyl urea derivative , 11.2gm/5.0gm 5gm/3gm in 100 gm , paracetamol with cysteine hcl monohydarte infusion 1000mg/100ml , paracetamol 10mg/ml infusion in 50ml bott , common cold tab (antihistiminics + paracetamol 325/500 mg without pseudoephedrine) , inj paracetamol 1gm (bott of 100ml) , diclofenac diethylamine bo 4.64 w/v equivalent to diclofenac sodium ip 4.00 w/v absolute ip 10.00v/v in topical solution base (non aqueous) q.s , indomethacin 75 mg sr tab , promethazine syp 5mg / 5ml bott of 6 ml , dexamethasone sodium phosphate inj 4.4 mg (equivalent to dexamethasone phosphate 4 mg/ml) vial of 2 ml , pheniramine maleate inj 22.75 mg per ml amp of 2 ml , tab methylprednisolone 16 mg , inj promethazine hcl 2.5% 25mg/ml , in 2 ml , pralidoxime inj 500mg per 20ml , carbamazepine tab 200 mg , carbamazepine 200 mg cr tab , clobazm tab 5 mg , clonazepam 2 mg tab , phenobarbitone sod inj 200mg in 1 ml amp , posphenytoin sodium 75mg/ml amp of 2ml inj , sodium valproate100mg/ml inj , sodium valproate 200 mg/5ml bottle of 100 ml syrup , topiramate 25mg tab , baclofen tab 10 mg , salmeterol 25mcg + fluticasone 250 mcg autohaler , ivermectin tab 6mg , tab diethylcarbamazine 50mg , clotrimoxazole ip paed 100mg + 20mg , dapsone 50 mg tab , tab amitriptyline 25 mg , artesunate (a) + sulphadoxine-pyrimethamine (b) combi pack (b) 1 tab 25mg (a)+1 tab (250mg+12.5mg) , amphotericin-b inj 50 mg vial , clotrimazole mouth paint 1% bottle of 15 ml , fluconazole infusion inj 2 mg/ml 100 ml bott , cap hydroxyurea 500 mg , methotrexate 2.5mg tab , tab trihexyphenidyl hcl 2 mg , acenocoumarol 1 mg tab , inj tranexamic acid 500 mg/5ml , choline salicylate and benzalkonium chloride gel of 10 mg , tab diltiazem controlled delivery) 90mg , fenofibrate 200 mg tab , isosorbide dinitrate tab 10 mg , tab glyceryl trinitrate cr 2.6 mg , inj adenosine 3 mg/ml 10 ml , amiodarone hcl 150 mg ml inj in 3 ml amp , metoprolol inj 1 mg/ml amp of 5 ml , propranolol tab 40 mg (indral) , ramipril tab 2.5 mg , digoxin tab 0.25 mg , digoxin 0.5 mg inj , dopamine hcl 40 mg/ml in amp of 5 ml inj , tab asprin 75 mg , clonidine tab 100 mcg , hydrochlorthiazide 25 mg tab , prazosin 2.5mg sustained release/slow release tab , prazosin 5mg sustained release/slow release tab , metoprolol 12.5mg tab , nicorandil 5mg tab , antiseptic mouth wash containing sodium fluoride & triclosan bott of 100 ml , benzocaine 20% , pectin based oral ointment tube of 5 gm , clove oil bottle of 50ml , desensitising paste (stannous fluoride/pottaslum nitrate/sodium monofluoride-phosphate) tube of 40-55 ml or gm , calamine 8% with 10% light liquid paraffin 50ml bott , betamethasone dipropionate usp 5mg and gentamycin sulphate 1mg/gm tube of 5gm , zinc oxide /titanium dioxide bott (spf 25-50) (sunscreen lotion) bottle of 60 ml

CTN :39852997

15 Apr, 2025 56.23 Lacs

Palghar - Maharashtra

Tender For medicine and surgical item purchase at hup - description, cap. vitamin d3 60k, cap. nifedipine 10mg, clobetasol + miconazole + neomycin ointment, diclofenac gel 1% 30mg, diclofenac spray, tab. aspirin 150mg, lignocaine 2% gel 30gm, tab. atorvastatin 10mg, betadine ointment 25gm, pcm drops 100mg/ml (15ml), syrup antacid (magnesium hydroxide), syrup cough expectorant, tab. amoxycillin + potassium calvanuate 625mg, tab. vitamin c 500mg, tab. azithromycin 500mg, tab. calcium lactate, tab. levocetirizine 5mg + montelukast 10mg, tab. cefixime 200mg, tab. diclofenac 50mg + paracetamol 500mg, tab. ondansetron 4mg, tab. tranexamic acid 500mg, tab. mvbc, tab. dicyclomine 10mg, ors powder 20.5gm packet, inj. diclofenac 1cc, inj. dexamethasone 2cc, inj. soda-bi-carb, inj. furosemide 10mg, inj. tramadol, inj. lignocaine 2%, inj. pheniramine 22.75mg, inj. pcm 175mg, inj. atropine, inj. busco pan, inj. ondansetron, inj. pantoprazole, inj. b complex, inj. cefotaxime, inj. ceftriaxone, inj. amoxycillin + potassium clavulanate 1.2gm, ns 100ml, ns 500ml, rl 500ml, dns 500ml, inj. hydrocortisone 100mg, water for injection, inj. mgso4, inj. iron sucrose 100mg, inj. metro 100ml, inj. vitamin k, tab. pantoprazole 40mg dsr, tab. aceclofenac + paracetamol, tab. albendazole 400mg, tab. fluconazole, tab. labetalol 100mg, neosporin powder, protein powder, inj. oxytocin, kmno4 crystals, i.v. 25% dextrose, inj. potassium chloride, inj. paracetamol infusion 1gm, syrup amoxycillin potassium clavulanate 250mg, syrup metronidazole 200mg, syrup ibuprofen 100mg, hydrogen peroxide 250ml bottle, inj. lignocaine with adrenaline yl, inj. xylocaine 2% pack of 24, dynaplast roll, 3-layer mask, mucus extractor, needle no.24, pediatric oxygen mask, proctolysis enema, antiseptic liquid (chlorhexidine gluconate) 500ml, sticking plaster, suction catheter, syringe with needle 2ml, syringe with needle 5ml, syringe with needle 10ml, syringe with needle 20ml + 50ml, syringe with needle 50ml, hydrogen peroxide and silver nitrate solution for fumigation 5 litres, distilled water 5 litres, doppler ultrasound gel 250ml, biomedical waste bag red color 1kg, biomedical waste bag black color 1kg, sodium hypochlorite 5 litres, scalp vein no.22 black color, i.v. set leur slip vented, iso propyl alcohol (medical spirit) 5litre, mackintosh sheet 3*6feet, cord clamp, foleys catheter no. 14, foleys catheter no. 16, urine bag, sticking tape, white bed sheets 90*60 inch, solapuri blanket 90*60 inch, baby blanket 100*80cm, draw sheet (cotton) width: 90-110cm, length: 150-180cm., turkish towel 40*60 inch, napkin 14*21 inch, washable pillow 28*17 inch, pillow cover 30*20 inch, mattress with rexin cover (waterproof mattress cover) 40*80 inch, baby wrapper 26*28 inch, cotton plain towel (green color), dynaplast easyfix for cannula fixation, foleys catheter no. 18, plain blood collection tube, edta blood collection tube, fluoride blood collection tube, sterile lancets accu chek safe t pro uno, blood collecting needle, urine strips (albumin / sugar), sickle cell anemia rapid test kit, gluco check (blood glucose test strips), electrolyte reagent (el-120), thermal paper roll 80mm*50mtr, agd 300 cbc analyser kit (autodil plus, autolyse plus, soak solution, thermal paper roll 57mm*40mtr), yellow tips, hbsag kit, vdrl kit, blood group kit, micro slide, forcep 6 inch ss, tissue paper roll, abdominal wall retractor, sponge holding forceps, doyen s retractor, deauer s retractor, allis forceps, towel clips, bab cock forceps, scissors tissue cutting, cheatle forceps, artery forceps, straight curve forceps, mosquito forceps curve, green armytage forceps, morris retractor 2 x3 x9 , self-retaining retractor, uterine holding forceps, sims speculum, vulsellum, uterine sound, gawn surgical, scrub suit, surgical cap, hole towel, drawsheet, green towel big, green towel small, bedsheet, blanket, doctor coat, washable plastic apron, rexine pillow, rexine apron, rexine mattress, patient dress (back dori), patient dress,

CTN :39278045

31 Mar, 2025 3.65 Lacs

Rajauri - Jammu And Kashmir

Tender For bid to ras tender for supply of clindamycin phosphate 1% topical gel tube of 10 gm , clobetasol propionate cream 0.05% in tube of 10 gm , framycetin sulphate cream bp 1% cream 20 gm , glycerin ( glycerol) in bott of 1 kg , cream miconazole nitrate 2% skin tube of 15gm , permethrin 5% tube of 30 gm , terbinafine 1% cream tube of 10 gm , tretinoin 0.1% tube of 20 gm , tab valaclclovir hcl 500mg , clarithromycin 1% gel 15 gm tube , fusidic acid cream 2% w/w 10 g tube , para dichlorobenzene 2% w/v benzocaine 2.7% w/v chlorbutol 5% , turpentine oil 25 % w/v bott of 10 ml(waxol) , povidone iodine germicidal mouth wash 2% w/v bott of 60ml , chlorohexidine gluconate solution 5% , chlorhexidine gluconate solution equivalent to 4% w/v with isopropanol 10% ethoxylated alkyiphenol 10% 500ml bott with dispencer (500ml per bott) , povidone iodine 10% solution , bott of 500 ml , glutaraldehyde 2% aqueous sol with activator (cidex) , liquid antiseptic chlorhexidine gluconate bp 7.5% v/v cetrimide bp 15% w/v & alcohol 6-10% w/v solution 500 ml bott (savlon) , bacillus ciasuil 2 billion spores/5ml (enterogermina) , chlordiazepoxide (5mg)n+ clidinium (2.5mg) + dicyclomine (10mg) tab , antispasmodic tab containing mefenamic acid 250mg & dicyclomine hcl 10mg , levosulpride 25mg tab , entacavir 0.5 mg tab , trypsin with chymotrypsin 100000 armour units tab , metoclopramide syrup 5mg/5ml bott of 30 ml , dicyclomine hcl 20mg inj , tab/cap dicyclomine hcl 10mg , dextroprop oxyphen hcl 65mg acetamenophen ip 400mg , hyoscine bromide inj 20 mg/ml , 01 ml inj , mebeverine hcl ( 135mg) tabs , bisacodyl tab 5 mg (perpn tab) , tab hydrocortisone 20 mg , clotrimazole vaginal pessary 100mg , tab nor-ethisterone 5mg , inj magnesium sulphate 50% w/v , sitagliptine 50mg + metformin 1000mg tab , cough lozenges , neostigmine inj 0.5 mg in 1 ml ampoule , pyridostigmine tab 60 mg , succinylchloline chloride inj 50 mg/ml vial of 2 ml , vecuronium bromide inj 4mg/ml amp of 1 ml , tab calcium acetate 500 mg , protein supplement formula for renal patients , tacrolimus 1 mg tab , tacrolimus 0.5mg cap , tab sevelamer 400 mg tab , oint luliconazole 1% w/v tube of 30 gm , anti histamine syp each 5 ml containing diphenhydramine hcl 12.5mg , tab betahistine dihydro chloride 8mg , cinnarizine tab 25 mg , xylometazoline hcl 0.05% w/v nasal solution bott of 10ml , metronidazole susp 200 mg/5ml bott of 60 ml , ondansetron syp 2 mg/5 ml in bott of 30 ml , iron drops paediatric containing ferrous fumerate 25mg/ml vit b12 12.5mg/ml & folic acid 200mg/ml bott of 15ml , syrup calcium phosphate (80 mg/5 ml)200 ml bottle , tab alprazolam 0.25 mg , chlordiazepoxide 10 mg tab , clonazepam 0.5 mg tab , duloxetine 20 mg tab , fluoxetine hcl cap 20 mg , tab lorazepam 1 mg , tab risperidone 2 mg , tab acamprosate 333 mg , tab olanzapine 10 mg , tab sertraline 50mg , tab zolpidem 10 mg , formetrol 20mcg + budesonide 0.5mg respules , ipratropium bromide respirator soln 250 mcg/ml vial of 15ml , salbutamol sulphate respirator solution 5mg/ml , vial of 15 ml , titropium bromide 9mcg 120mtr dose inhaler , cough syrup each 5ml contains chlorpheniramine maleate ip 3mg , ammounium chloride ip 110mg , sodium citrate iop 46mg , menthol ip 0.9mg , syrup codeine phosphate 10 mg + chlorphenaramine maleate 4 mh per 5 ml bottle of 100 ml , syrup tabutaline sulphate 1.25 mg + bromphexine hcl 4 mg + guaphenesin 50 mg per 5 ml bottle of 100 ml , dextrose monohydrate for oral use pkt of 100gm

CTN :39856104

07 Apr, 2025 2.50 Lacs

Multi City - Karnataka

Tender For purchasing of chemicals consumables to chemistry research center gec ramanagara-, , zinc nitrate hexahydrate [zn(no3)2. 6h2o], , cerium nitrate hexahydrate [ce(no3)3. 6h2o], , chromium nitrate nonahydrate [cr(no3)3 .9h2o], , cobalt nitrate hexahydrate [co(no3)2.6h2o], , copper nitrate hexahydrate [cu(no3)2.6h2o], , silver nitrate [agno3], , titanium nitrate [ti(no3)4], , magnesium nitrate hexahydrate [mg(no3)26h2o], , nickle nitrate hexahydrate [ni(no3)26h2o], , cadmium nitrate [cd(no3)2], , chromium (iii) nitrate nonahydrate [cr(no3)3.9h2o], , sodium nitrate (nano3), , sodium nitrite (nano2), , strontium nitrate [sr(no3)2], , bismuth nitrate [bi(no3)3)], , iron nitrate (ferric nitrate) [fe(no3)3.(h2o)n], , zirconium nitrate [zr(no3)4], , gadalonium nitrate [gd(no3)3], , tin (iv) chloride pentahydrate [sncl45h2o], , titanium isopropoxide [ti{och(ch3)2}4.], , niobium (v) nitrate [nb(no3)5], , ammonium nitrate (nh4no3), , zinc sulphate (znso4), , copper sulphate (cuso4), , magnesium sulphate heptahydrate (mgso4.7h2o), , nickle sulphate hexahydrate (niso46h2o), , chromium sulphate hexahydrate [cr2(so4)36h2o], , cerium sulphate hexahydrate [ce(so4)26h2o], , manganese acetate tetrahydrate [mn(ch3coo)24h2o], , zinc acetate heptahydrate [zn(ch3coo)27h2o], , zinc acetate hexahydrate [zn(ch3coo)26h2o], , chromium acetate [cr(ch3coo)2], , tetraethyl orthosilicate (teos) [si(oc2h5)4], , sodium silicate (na2sio3), , sodium metasilicate pentahydrate [na2sio35h2o], , sodium metavanadate [navo3], , vanadyl sulphate hydrate [voso4.xh2o], , chromium sulphate [cr2(so4)3], , ammonium, , tungstate, , pentahydrate, , [(nh4)10(h2w 12042)5h2o], , ammonium vanadate (nh4vo3), , sodium tungstate dihydrate (na2wo4.2h2o), , tungsten hexacarbonyl [w(co)6], , tungsten hexachloride (wcl6), , sodium bicarbonate (nahco3), , sodium hydroxide (naoh), , sodium chloride (nacl), , sodium sulphate (na2so4), , sodium lauryl sulphate (sls), , sodium dodecyl sulphate (sds), , cetyl trimethyl ammonium bromide (ctab), , boric acid (h3bo3), , ammonium hydroxide (nh4oh), , ammonium chloride (nh4cl), , hydrochloric acid (hcl), , sulphuric acid (h2so4), , ethylenediaminetetraacetic acid (edta) [c10h16n2o8], , potassium hydroxide (koh), , ethanol (c2h5oh), , urea [nh2conh2], , glycine [c2h3no2], , 2, , 4, , citric acid [c6h8o7], , acetone [ch3coch3], , nickel mesh (to prepare working electrode), , nickle foam, , 6, , nafion [c7hf13o5s c2f4], , 7, , whatmann filter paper (no. 41), , tissue paper (laboratory grade)

CTN :39856343

04 Apr, 2025 6.96 Lacs

Multi City - Karnataka

Tender For supply of cataract surgeries drugs and consumables to dbcp dhandfws, ballari for the year 2024-25/call-3 - homatropine hydrobromide eye drop ip 5ml (1x1), sodium chloride opthalmic solution usp 10 ml (1x1), ofloxacin & dexamethasone 10 ml (1x1), flurbiprofen eye drops ip 5ml. (1x1), tropicamide plus eye drops 5ml (1x1), tab acetazolamide 250 mg (1x15 tablets), inj tryphoneblue 1 ml (1x1), inj adrenaline 1mg + sodium metabisulphite 0.1% (1ml) (1x1), inj pilocarpine nitrate 1ml (1x1), inj hypromellose usp 5ml (1x1), inj hyaluronidase ip 1500 iu (1x1), inj dexamethasone sodium phosphate 2ml (1x1), inj gentamycin 80mg 2ml (1x1), inj bupivacaine hydrochloride ip 0.5% (20 ml) (1x1), inj xylocaine adrenaline astridl (30 ml) (1x1)

CTN :39858862

18 Apr, 2025 NA

Kolkata - West Bengal

Tender For supply of e salce oint moxifloxacin 0.5 percent tube of 5gm , bimatoprost 0.01percent w slace v with bak 0.02 percent , 3ml , brimonidine tartrate 0.15 percent plus stabilized oxychloro complex purite plus carboxymethyl cellulose , e slace d brinzolamide 1 percent , e slace d gatifloxacin 0.5 percent preservative free , atropine sulphate 1 percent w slace v bott of 3 ml , e slace d hydroxy propyl methyl cellulose hypromellose 0.3 percent with sodium perborate, sodium chloride, potassium chloride , eye gel hydroxypropyl methylcellulose hypromellose 0.3 percent ,carbomer 980 10 gm tube , lotepredenol etabonate 0.5 percent bott of 5 ml eye drop , povidone 5 percent eye drop bott of 5 ml , proparacaine hydrochloride 0.5 percent eye drop , tropicamide 1 percent with 5 percent phenylephrine eye drops, bott of 5 ml , cyclosporine emulsion 0.05 percent with glycerine , castor oil , polysorbate 80, carbomer 1342, preservative free aa pack of 30 vial of 0.4 ml each , nepafenac 0.3 percent w slace v eye drops, bottle of 5 ml , cyclopentolate hcl 1 percent opth soln bottle of 5 ml. , tobramycin 0.3 percent bott of 5 ml. , pilocarpine nitrate eye solution 2 percent bott of 5 ml , homatropine hydrochloride 2 percent e slace d , ketorolac tromethamine 0.4 percent eye drop , e slace d olopatadine hydrochloride 2.2mg sterile with drop tainer dispenser 2.5ml , timolol maleate 0.5 percent preservative free with comod system. , eye drop brimonidine 0.2 percent plus b brinzolamide 1percent , bottle of 5 ml bid number/ & ( * ) : gem/2025/b/6064161 dated/ + : 28-03-2025 bid document/ 3 3 1 / 24

Central Government/Public Sector

CTN :39857974

18 Apr, 2025 1.39 Lacs

Kanpur - Uttar Pradesh

Tender For supply of agno3 0.1 mol/l, silver nitrate solution, 0.1 mol/l (n/10) , buffer solution ph-7.0 , buffer solution ph- 4.0 , buffer solution ph-9 , ethenol , ammonia solution 25% , sodium thiosulphate std sol (n/10) , sulphuric acid std, solution, 1 n , edta 0.1 mol/l , sodium hydroxide std sol (n/10) , sodium hydroxide std sol (1 n) , silver nitrate , potasium iodide , disodium oxalate

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Water Proofing Material Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

corporations/Associations/Others

Central Government/Public Sector