Zinc Chloride Tenders

Get complete information related to latest Zinc Chloride Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Zinc Chloride Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Zinc Chloride Tenders .

Filter

Loading....

Get Tender in Email

Corporations And Associations And Others

CTN :39422929

21 Apr, 2025 51.44 Crore

Panchkula - Haryana

Tender For corrigendum : online tender for the rate contract for the supply of dental items to various hospitals of government of haryana for a period of two years for group c - cotton rolls ( small, pkt of 1000 pcs), disposable patient drape sheet 1*1mm, gum paint based on tannic acid, potassium iodide, zinc chloride, glycerine with thymol/ menthol /cetrimide, liquid 15 ml bottle, hybrid composite resin for anteriors (all shades), high strength, long lasting wear resitance, great handling without stick, 4 gm isi/ iso/ce/marked., rubber dam kit adult, box of 152*152 mm, medium rubber dam sheets, 152 mm template, 152 mm plastic dental dam frame, 6-11 clamps pack with clamp holder, rubber dam clamp forcep, rubber dam punch mdr/isi/iso/ce marked, glass ionomer cement- type-ix, high strenth for posterior teeth, chemical setting without shrinkage, strontium based, high flouride releasing, 12 to 15 gm powder and 5 to 10 gm liquid, mdr/isi/iso/ce marked, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel. shade :- pale yellow, shade :- pale yellow, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- yellow brown, mdr/isi/iso/ce certified /usfda, restroative cement type - ii - (15 gm powder & 10 to 13 gm liquid), strontium based, radiopaque glass ionomer with high fluoride release, resistant to demineralization,hydrophylic properties, flouride releasing, high compressive stregth, low solubility, low flexure strength, bonds to both dentin and enamel., shade :- dark grey, mdr/isi/iso/ce certified /usfda, disposable suction tips pkt of 100, mineral trioxide aggregate mdr/isi/ iso/ce/marked., silver alloy non gamma-2 lathe cut alloy, 30 gm vial mdr/isi/iso/ce marked, niti hand files (21 mm) size- 15-40, for curved canals, pkt. of six mdr/isi/iso/ ce marked, pit & fissure sealant ( 6 ml bottle) solution with high flouride releasing, low viscocity, high retention, rapid cure & low solubility. mdr/isi/iso/ce marked/usfda, preadjusted edgewise stainless steel bracket kit containing upper and lower 2nd premolar to 2nd premolar bondable brackets with upper triple and lower double weldable molar tubes and mbt 0.022 prescription, fiber- reinforced splinting material- bondable reinforced ribben fiber-approx 2mm width mdr/isi/ iso/ce/marked., niti rotary files 4% 21mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be specified at the time of order), addition silicone impression material (600 ml putty with 2 cartridges of 50 ml light body), air rotor spray isi/iso/ce marked, calcium hydroxide, paste system based and catalyst -radiopaque, 4 gm mdr/isi/iso/ce marked, acidulated phosphate fluoride gel 1.25%(apf), gic luting pkt. of 30-35gm powder, flowable composite 2-4 grams, x-ray processing solution(set of developer & fixer powder, manual, to make 13.5 ltr solution), root canal spreaders pkt. of 6 #15-40 21mm, dental chair covering sterilized cling foil rolls mdr/isi/ iso/ce/marked., mta pkt. of 1gm, tooth preparation kit (set of 14 burs), root canal k files 21mm (pkt. of 6) #15-40, dental amalgam capsules pkt. of 50 capsules, impression compound, gic restorative pkt. of 10-15 gm powder, bleaching kit, diamond burs- various shapes including round, tapered round, flat fissure, pear (size and shape of burs required will be specified at the time of order)- coarse / fine grit. pkt of 5, niti rotary files 4% 25mm (pkt. of 6). refill packs of #15,#20,#25,#30,#35,#40 (size to be spe

State Government

CTN :39919589

19 Apr, 2025 NA

Patiala - Punjab

Tender For lab kits consumables and other items for rajindra hospital patiala - paper roll, pti kt, g6pd kits, methanol 2.5ltrs bottles, leishman stain powder (bottel), 10% sodium hypchlorite (liters), liquid paraphin (bottels), retic stain (bottels-125 ml), spirit (liters), test tubes, micro capillary tubes (box ), slides (box), westergren pipttes, edta vaccutainers, plain vaccutainer, sodium flouride, pti vaccutainer, esr vaccutainer, urine containers, syringe (20ml), syringe (10ml), syringe (5ml), syringe (2ml), disp.gloves( 7.5), disp.gloves( 7.00), disp.gloves( 6.5), cotton (bundles), bone marrow needle (no.14, bone marrow needle (no.16, bone marrow needle (no.18, jamshidi needle, lignocane 2% 30ml (bottels), micropore (pc), betadine (bottles), urine strips (box), nitrile gloves (box), blotting sheet 2 bundles (1000 sheets ) boxes, cover slip boxes, gentamicin 120mg hlg (vials), ceftazidime + clavulanic acid (30mg+15mg) (vials), ciprofloxacin (30 mg) (vials), ceftriaxone (30 mg)(vials), teicoplanin (30mg) (vials), azithromycin (30mg) (vials), cefoperazone + sulbactam (30 mg+15mg) (vials), nutrient agar (500 gms) boxes, potato dextrose agar (100 gms) boxes, nutrient gelatin (100gms) boxes, of basal media (100 gms) boxes, nitrate broth (100gms) boxes, cled agar with andrade s indicator (500gms) boxes, corn meal agar (500 gms) boxes, hi chrome candida differential agar (100gms) boxes, dextrose (500gms) boxes, sucrose (500gms) boxes, mannitol (500gms) boxes, lactose (500gms) boxes, acetone (litre x 5), lead acetate (500 gm), acid carbolic (500 gm), acid sulphuric (2.5l ), acid acetic, disodium hydrogen phosphate (500 gm), ferric chloride ar (500 gm), glycerine (500 gm), toluidine (gm), i- phenylalanine (500 gm), neutral red (125 gm), acid fuchsin ( 25 gm), basic fuchsin (25gm), potassium tellurite (25gm), sodium taurocholate (500 gm), sodium hydroxide (500 gm), di potassium hydrogen orthophosphate (500 gm), methyl red reagent (100ml), andrade s indicator (100ml), alpha napthylamine (500gm), potassium iodide (100gm), sulphanillic acid 0.8% (100 ml), n, n, n ,n- tetramethyl-p-phenylenediamine dihydrochloride (5g), potassium hydroxide (500gm), widal test kit 4x5ml (to,th,ah,bh) (kits ), crp latex slide agglutination kit (50 tests), ra latex slide agglutination kit (50 tests), aso latex slide agglutination kit (50 tests, ppd 5 tu/ 0.1 ml & 10 tu/0.1 ml (vial), upt strip test, toxoplasma strip test, rpr strip test, hav rapid card, hev rapid card, hep b core antibody igm and igg elisa, rubella igm elisa, cmv igg elisa, hsv-1&2 igm - elisa, petri dish 3 (pc), petri dish 4 (pc), petri dish 4"disposable (pc), durhams tube, over slips (20 boxes (400 packets), blood culture bottles (50ml) 1367019 (bottles), blood culture bottles (160ml) 1367019 (bottles), whatman filter paper rim, filter paper rim (ordinary) (rim), gloves (pair), masks (disposable ), heating elements (autoclave) (elements), insulin syringes, t3 (96 wells), t4 (96 wells), tsh (96 wells), vitamin d 3 (96 wells), lh (96 wells), fsh (96wells), prolactin (96 wells), testosterone (96 wells), psa (96 wells), ca-125 (96 wells), cea (96 wells), ca-15.3 (96wells), alpha fetoprotein (afp) (96wells), ca-19.9 (96 wells), ferritin (96wells), insulin (96 wells, beta hcg (96 wells), amylase, cpk-mb (20x1.1 ml), ldh (20x1.1 ml), cpk total(ck-nac) (15x1.1 ml), phosphorous (2x50 ml), calcium (2x50 ml), micro protein kits for csf (1x50 ml), blood urea kit (2x1 litre), uric acid (4x50 ml), cholestrol 5x20ml, triglycerides 5x20ml, sgot 5x20, sgpt 5x20, alp 5x20 ml, glucose 2x200 ml, total bilirubin 4x50 ml, ammonium sulphate 500gm/(ar) ( packs), disodium phenyl phosphate 100gm per pack (ar) ( packs), trichloracetic acid (tca) ar 500gm ( packs), methanol (ar) 2.5 ltr per pack ( packs), trisodium citrate (ar) 500gm per apck ( packs), methylated sprit (ar) 5lrt per apck ( packs), sodium dihydrogen phosphate (nah2po4) (ar) ( packs), sulphur powder ar 500gm per pack ( packs), liquor ammonia ar 250 m

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39626309

16 Apr, 2025 47.00 Crore

Mumbai - Maharashtra

Tender For purchase of drug - abacavir , abacavir + lamuvidine , aciclovir , aciclovir , aciclovir , aciclovir , aciclovir , aciclovir , aciclovir 10 gm , aciclovir 5 gm , amikacin sulphate , amikacin sulphate , amikacin sulphate , amoxycillin , amoxycillin , amoxycillin , amoxycillin , amoxycillin , amoxycillin , amoxycillin + clavulanic acid , amoxycillin + clavulanic acid , amoxycillin + clavulanic acid , amoxycillin + clavulanic acid , amoxycillin + clavulanic acid , amoxycillin + clavulanic acid , amoxycillin + cloxacillin , amoxycillin + cloxacillin , amoxycillin + dicloxacilln + lactobacillus , amoxycillin + lactobacillus , amphotericin b , amphotericin b 30 gm , amphotericin b liposomal in ns , ampicillin + sulbactum , ampicillin + sulbactum , anidulafungin , arbekacin , azithromycin , azithromycin , azithromycin , azithromycin , azithromycin , aztreonam , aztreonam , benzocaine 15 gm , benzydamine 100 ml , betamethasone + clioquinol 30 gm , betamethasone + gentamycin + miconazole 20 gm , betamethasone + neomycin 25 gm , betamethasone + zinc sulphate 30 gm , betamethasone + zinc sulphate 50 ml , betamethasone + clotrimazole 15 gm , betamethasone + clotrimazole 30 gm , betamethasone dipropionate 30 gm , betamethasone dipropionate 15 gm , betamethasone + salicilic acid 20 gm , betamethasone + salicilic acid+zinc oxide 30 gm , betamethasone valerate 30 gm , betamethasone valerate 20 gm , calamine + aloe vera 100 ml , calamine + diphinhydramine 100 ml , cefadroxil , cefadroxil , cefepime , cefepime + sulbactam , cefepime + sulbactam , cefepime + tazobactam , cefepime + tazobactam , cefixime , cefixime , cefixime , cefixime , cefixime , cefixime + clavulanic acid , cefixime + clavulanic acid , cefixime + clavulanic acid , cefixime + ofloxacin , cefoperazone , cefoperazone , cefpodoxime , cefpodoxime , cefpodoxime , cefpodoxime , cefpodoxime , cefpodoxime + clavulanic acid , ceftaroline fosamil , ceftazidime , ceftazidime , ceftazidime , ceftazidime , ceftazidime + sulbactam , ceftazidime + sulbactam , ceftazidime + tazobactam , ceftazidime + tazobactam , ceftazidime + tobramycin , ceftriaxone , ceftriaxone , ceftriaxone , ceftriaxone + disodium edetate + salbactum , ceftriaxone + disodium edetate + salbactum , ceftriaxone + tazobactam , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cefuroxime , cephalexin , cephalexin , chlorhexidine + sodium fludride + zinc chloride 200 ml , chlorhexidine gluconate mouth paint 15 gm , chlorhexidine 150 ml , chlorhexidine 500 ml , chloromphenicol , chloromphenicol 10 ml , choline salicylate + lignocain hcl + benzalkonium chloride 10 gm , choline salicylate + lignocain hcl + benzalkonium chloride 15 gm , choline salicylate + lignocaine 10 gm , choline salicylate +benzalkonium chloride 10 ml , ciprofloxacin , ciprofloxacin , ciprofloxacin , ciprofloxacin , ciprofloxacin , ciprofloxacin + dexamethasone 10 ml , ciprofloxacin + dexamethasone 5 ml , ciprofloxacin + ornidazole , ciprofloxacin + tinidazole , ciprofloxacin + tinidazole , ciprofloxacin 10 ml , clarithromycin , clarithromycin , clarithromycin , clarithromycin 15 gm , clindamycin , clindamycin , clindamycin , clindamycin , clindamycin + clotrimazole , clindamycin + clotrimazole , clindamycin 20 gm , clotrimazole , clotrimazole , clotrimazole , clotrimazole , clotrimazole + beclomethasone + neomycin 10 gm , clotrimazole + beclomethasone 20 gm , clotrimazole + beclomethasone 30 ml , clotrimazole + lidocaine 10 ml , clotrimazole + lignocain 10 ml , clotrimazole 100 gm , clotrimazole 15 gm , clotrimazole 15 ml , clotrimazole 25 ml , clotrimazole 30 ml , clotrimazole 75 gm , colloidal silver 15 gm , corticotrophin(acth) , cotrimoxazole , cotrimoxazole , cotrimoxazole (sulfamethoxazole + trimethoprim) , daclatasvir dihydrochloride , daptomycin , desmopressin acetate , desmopressin acetate , dienogest , doripenem , doxycycline , doxycycline + lactic acid bacillus , efavirenz , entecavir , entecavir , ertapenem , erythromycin , erythro

Loading, Please wait...

Zinc Chloride Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Corporations And Associations And Others

State Government

State Government

Central Government/Public Sector

State Government