Web Analytics Made Easy - StatCounter

Zirconium Nitrate Tenders

Get complete information related to latest Zirconium Nitrate Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Zirconium Nitrate Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Zirconium Nitrate Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government And Public Sector

CTN :40685534 Due date: 04 Jul, 202504 Jul, 2025 NA
Tender For tender for supply of ifn lamda 1 elisa cat no sb ekh 2559 , ifn lamda 2 elisa cat no sb ekh 4908 , ifn lamda 3 elisa cat no sb ekh 1183 , ifn lamda 4 elisa cat no sb ekh 4905 , ccl2 elisa cat no sb ekh 1312 , ccl19 elisa sb ekh 4911 , ip 10 elisa cat no sb ekh 4909 , dimethyl sulfoxide dmso 100ml , stemcell technologies lymphoprep 250ml

Central Government And Public Sector

CTN :40674063 Due date: 03 Jul, 202503 Jul, 2025 NA
Tender For supply of quagen multiplex pcr kit100 cat.no 206143 , dimethyl sulfoxide molecular grade cat.no d8418-50 ml. sigma , primer lis-f 5ataccatgg tta ccc cat tgagc3 , primer lis-r 5agggctcattacatgtggaccc3 , primer 4.2-f 5ggtttacccatgtggtgcctc3 , primer 4.2-r 5cccgttggatcttctcatttccc3 , primer a2-r 5agaccaggaagggccggtg3 , primer a23.7-f 5cccctcgccaagtccaccc3 , primer 3.720.5-r 5aaagcactctagggtccagcg3 , primer 0bg1 5- aactgttgctttataggatttt-3 , primer 1bg1 5- aggagcttattgataacctcagac-3 , primer cd26g-ahb e n- taa ccttgataccaacctgcccagggcgtc , primer cd26g- ahb e m-taaccttgataccaacctgcccagggcgtt , exosap express pcr product cleanup cat.no 75001-200ul appliedbiosystems

CTN :40645774 Due date: 30 Jun, 202530 Jun, 2025 NA
Tender For supply of topical antiseptic ayurvedic spray container of 250 ml , inj tribivet vial of 100 ml , copper sulphate , ceftriaxone sodium 01 gm inj , inj meloxicam plus pcm vial of 30 ml , inj enrofloxacin 100 mg per ml vial of 50 ml , ear drops containing lactic acid and salicylic acid bottle of 100 ml , frusemide inj containing frusemide 50 mg per ml vial of 10 ml , inj flunixin 100 ml , gentamycin and clobetasol bott of 30 ml , dicylomine hci 20 mg inj vial of 30 ml , anti bloat liquid 100 ml , dimethyl sulfoxide dmso , inj ketamine hcl 10ml , inj ketoprofen vial of 30 ml , dog shampoo containing benzyl peroxide , inj meloxicam 30 ml , antimycosis shampoo containing miconazole bott of 100ml , magnesium sulphate 300 gm , mecobalamin with b complex vial of 30 ml inj , inj oxytetracycline vial of 30 ml , inj avil vial of 30 ml

State Government

CTN :40458011 Due date: 24 Jun, 202524 Jun, 2025 NA
Tender For corrigendum : rate contract for supply of laboratory consumables (ntep) - group 1 - chemicals, drugs, and disinfectants, phenol crystals (carbolic acid), sulphuric acid, sodium hypochlorite, methylene blue, potassium dichromate, basic fuchsin, immersion oil liquid paraffin (heavy grade), sodium hydroxide, tri sodium citrate, disodium hydrogen phosphate, potassium dihydrogen phosphate (anhydrous), n-acetyl-l cystein, potassium permanganate(kmno4), formalin/ formaldehyde, magnesium sulphate, magnesium citrate (tribasic), asparagine, malachite green, glycerol, para nitro benzoic acid-, sodium chloride, middle brook 7h9 broth base, middle brook oadc enrichment media, brain heart infusion agar, silver nitrate, dimethyl sulfoxide, bovine serum albumin, sodium carbonate, oxalic acid, tween-80, tween 20, hydrogen peroxide, niacin strips, auramine o, zinc dust, hydrochloric acid, immunochromatographic test (rapid identificationtest) for mtb, group 2 drugs, rifampicin, isoniazid, ethambutol di hydrochloride, dihydro streptomycin sulphate, ofloxacin, ethioniamide, kanamycin sulfate, amikacin disulphate, capreomycin sulfate, levofloxacin, moxifloxacin, para amino salycylic acid (pas), linezolid, clofazamine, group 3- personal protective equipment (ppe), latex gloves (size- small), latex gloves (size- medium), latex gloves (size- large), nitrile gloves (size-small), nitrile gloves (size- medium), nitrile gloves (size- large), laboratory coats (size- small), laboratory coats (size-medium), laboratory coats (size-large), respirators (n95 mask), surgical gowns (size- small), surgical gowns (size- medium), surgical gowns (size- large), head cover, shoe cover, group 4a - pipettes tips for phenotypic use, 1-200 l pipette tips, 20-200 l pipette tips, 100-1000 l pipette tips, 100-1000 l pipette tips (long tip), pasteur pipettes (sterile individually packed), group 4b- pipette tips for molecular lab use, 1-10 l pipette tips, 1-20 l pipette tips, 1-200 l pipette tips, 20-200 l pipette tips, 10-100 l pipette tips, 100-1000 l pipette tips, pasteur pipettes, group 5- glasswares, culture tubes or universal glass bottles (mccartney bottles), slides, glass ware -round flat bottom flask -1 lit, glass ware for stain preparation measuring cylinder - graduated 100 ml, measuring cylinder-graduated 500 ml, measuring cylinder-graduated 1000 ml, glass stoppered bottles -250 ml, container for stain -250 ml polyethylene, flat bottom flask - 3 lit, flat bottom flask - 1 lit, pipette- glass graduated -1ml, pipette- glass graduated -2ml, pipette- glass graduated -5ml, pipette- glass graduated -10ml, glass beaker- 500ml, glass beaker- 250ml, bijou bottles, glass beads (3 mm), glass beads (5 mm), beaker- 250 ml, beaker- 100 ml, beaker- 500 ml, beaker- 1000 ml, glass test tubes, funnels - 5 cm diameter, funnels - 10cm diameter, funnels - 18cm diameter, volumetric flask - 50 ml, volumetric flask - 100 ml, volumetric flask - 1000 ml, 1 lit bottle - amber colour, 2 lit bottle- amber colour, 1 lit reagent bottle transparent, 2 lit reagent bottle- transparent, 500 ml reagent bottle- transparent, 250 ml. reagent bottle- transparent, petri dishes (glass), group 6- disposable items, 50 ml polypropylene (pp) tubes for centrifuge (sterile), 15 ml polypropylene (pp) tubes for centrifuge (sterile), micro-centrifuge tube, sterile with cap, 1.5 ml, cryo-vial, sterile with cap, 2 ml (for long term storage), cryo vial storage boxes, cryotag, bags for waste bin 60 litres, bags for waste bin 30 litres, bags for waste bin- 2 litres, single use syringes, sterile- 10 ml, single use syringes, sterile- 20 ml, syringe filter (0.22um) for single use, sterile, filter paper sheets (for work benches), single-use paper towels, 2 ml standard reaction tube, pcr tubes (0.2 ml), forceps, sterile, individually wrap,, petri dishes (plastic), disposable loops 10 l, group 7- general lab items, bunsen burner, safety gas tubing, test tube rack, loop holders, loop wire, loop wire, inoculation loops 4mm, inocul

CTN :40580715 Due date: 24 Jun, 202524 Jun, 2025 NA
Tender For supply of chemicals glassware plasticware - 3 4 dinitrosalicyclic acid , 4 methyl catechol , 5 5 dithiobis 2 nitrobenzoic acid dtnb 98 percent ellman s reagent , acetate buffer , acetone , agar agar powder , amphotericin b , ascorbic acid solution , boric acid , bouin s fluid , cedar wood oil , chitin , chloramphenicol , citrate buffer ph 6.1 , citric acid , citric acid monohydrate , deet diethyltoulamide , dimethyl sulfoxide dmso , disodium hydrogen phosphate , edta , ethanol , ethyl acetate , fluon , formaldehyde , glycerine , gram stains kit , guaiacol solution , h2o2 solution , hcl , hydroxylamine hydrochloride , iso propyl alcohol , lactophenol cotton blue , l phenylalanine , methanol , methionine , methyl 4 hydroxybenzoate , n acetyl glucosamine , nitric acid hno3 , nitroblue tetrazolium nbt , nutrient agar , perchloric acid , petroleum ether , phenol , phosphate buffer ph 7 , potassium bitartrate rochelle salt , potassium hydroxide , potassium permanganate kmno4 , potassium phosphate buffer ph 7.0 , potassium phosphate dibasic , potassium phosphate monobasic , potassium sodium tartrate tetrahydrate , potato dextrose agar , pure superoxide dismutase , riboflavin , sodium bicarbonate , sodium carbonate , sodium carbonate buffer , sodium chloride , sodium citrate dihydrate , sodium hydroxide , sodium hypochlorite solution 4 percent liquid , sodium phosphate buffer , sodium sulfite , sodium tetraborate , sorbic acid , sulphuric acid h2so4 , tris hcl , triton x , tween 20 , wheat germ , xylene , yeast powder , beakers , plastic beaker set , reagent bottle with screw caps , reagent bottles with screw caps , reagent bottles with screw caps 1000 ml , graduated cylinder , graduated cylinders , conical flask , mohr pipette , glass stirrer rod , glass slides , cover slips , test tubes along with stand , cuvette , neubauer chamber , thermometer , culture petri dishes , funnels , glass syringes , spreader , buchner filtration funnels , buchner vacuum filtration funnels , filtering flask buchner with side arm socket , vacuum filtering flasks buchner with side arm socket , flat bottom evaporating dish , watch glasses , crystalizing dishes , desiccator set , separating funnel pear shaped , storage and sampling vials clear with write on patch , burette , filter paper , ptfe filter paper , pvdf filter paper , inoculating loop , metal loops holder , inoculating needle , forceps , forceps blunt , spatula , cork borer set , rubber bulb , bunsen burner , magnetic stirring bar retriever , cryo gloves , nitrile gloves , centrifuge tubes , centrifuge tube , falcon tube centrifuge rack holder , parafilm m roll , parafin wax , wash bottle , eppendorf tube , burette stand set , pasteur pipette , lab eye protection goggles , test tube rack , test tube basket , draining tray , plastic wrap bid details/ 2 / 130

Central Government/Public Sector

CTN :40491750 Due date: 17 Jun, 202517 Jun, 2025 NA
Tender For supply of chemical - dimethyl sulfoxide 500mlpk , sigmafasttm 3 3 diaminobenzidine tablets 50 sets , tryptose phosphate broth suitable for insect cell culture 500g pk , o phenylenediamine dihydrochloride 100tab5mg , sodium bicarbonate powder bio reagent for molecular biology suitable for cell culture suitable for insect cell culture 500g pk , 8 channel manifold polypropylene for quiksip bt aspirator 1ea , latex beads polystyrene 3 point 0 m mean particle size 2mlpk , corning roller bottles tissue culture treated clear polystyrene sterile bottle surface area 850 cm cap easy grip case of 20

Central Government And Public Sector

CTN :40447448 Due date: 13 Jun, 202513 Jun, 2025 NA
Tender For supply of fetal bovine serum,fetal bovine serum,bovine serum albumin for molecular biology,bovine serum albumin for molecular biology,dulbecco modified eagle medium dmem,dulbecco modified eagle medium dmem,phosphate buffered saline,phosphate buffered saline,tri-potassium citrate monohydrate assay,tri-potassium citrate monohydrate assay,manganese ll chloride tetrahydrate,manganese ll chloride tetrahydrate,ferrous sulphate heptahydrate,ferrous sulphate heptahydrate,brain heart infusion agar,brain heart infusion agar,dntp mix, 40mm,dntp mix, 40mm,counting chamber blaubrand neubauer improved without clips, double ruled,counting chamber blaubrand neubauer improved without clips, double ruled,dimethyl sulfoxide,dimethyl sulfoxide,grace bio-labs coverwelltm perfusion chambers,grace bio-labs coverwelltm perfusion chambers,acetylcholine chloride,acetylcholine chloride,trypan blue,trypan blue,cholesterol grade,cholesterol grade,puromycin dihydrochloride from streptomyces alboniger,puromycin dihydrochloride from streptomyces albo

Central Government And Public Sector

CTN :40441083 Due date: 13 Jun, 202513 Jun, 2025 NA
Tender For supply of rpmi 1640 medium 500ml 11875093 , facs flow sheath fluid pack size 20 l , d2650 100ml dimethyl sulfoxide sigma aldrich , bda c cytometric bead array cba human il 10 flex set catalog no 558274 human il 10 capture bead b7 51 9005291 human il 10 pe detection reagent 51 9004043 , bda c cytometric bead array cba human ip 10 flex set catalog no 558280 human ip 10 capture bead b5 51 9005294 human ip 10 pe detection reagent 51 9004057 , bda c cytometric bead array cba human il 1i flex set catalog no 558279 human il 1i capture bead b4 51 9005302 human il 1i pe detection reagent 51 9004060

Central Government And Public Sector

CTN :40441204 Due date: 13 Jun, 202513 Jun, 2025 NA
Tender For supply of hu cd45 apc h7 2d1 , hu cd107a fitc h4a3 , hu cd157 pe sy 11b5 , percp by cyanine5 5 anti human igm antibody , dimethyl sulfoxide dmso d8418 50ml sigma , parafilm m 4x125 pack of 1 no
 Loading, Please wait...

Connect us via What's Up