Latest bogie frame horn adopter Tenders | Government bogie frame horn adopter Tenders

Central Government/Public Sector

CTN :39837524

02 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of washer and destruction part for the buffer as per drawing no. t-2-2-602 item no. 01. [ warr anty period: 30 months after the date of delivery ]

Central Government/Public Sector

CTN :39848341

04 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For supply of enhanced capacity side buffer plunger (casting) in rivetted condition with face plate, flat csk head rivet, buffer.........

Central Government / Public Sector

CTN :39848687

18 Apr, 2025 NA

Visakhapatnam - Andhra Pradesh

Tender For supply of coupler rod for upgraded high tensile centre buffer coupler

Central Government/Public Sector

CTN :39849253

16 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of buffer bolt tightening tommy & bar

CTN :39846761

07 Apr, 2025 NA

Kanchipuram - Tamil Nadu

Tender For supply of ms rectangle tube , 3mm thick 6m long ms square tube , ms square tube 2mm thick 6m , ms square tube 1 , ms flat 6 m long , ms flat 6 mm thick , 10 mm ms flat , ms flat 2 12 mm thick , pop rivet , self lock bolt , buffer , 3 feet buffer , rubber castor wheel assy , rubber wheel assy with heavy duty bracket

State Government

CTN :39834913

07 Apr, 2025 NA

Gurgaon - Haryana

Tender For supply of acetonitrile lcms grade , psa spe suitable , c18 spe suitable , magnesium sulfate anhydrous acs , phosphate buffer saline , sodium acetate anhydrous acs grade

Central Government/Public Sector

CTN :39835036

08 Apr, 2025 NA

Durg - Chhattisgarh

Tender For supply of overhauling kit , bushing time delay , triangular plate , drive shaft , ss plunger , pv plunger , ss bushing , power piston , flyweight , piston accumulator , buffer piston , cover , switch assembly , shutdown plunger , shutdown rod , oil gauge , valve losd bypass , speeder spring , bushing compensation , spring coupling , oil filler cap , nut , case solenoid , solenoid coil , plug and filter assembly , drain cock , gear ss , spring guard , spring acc inner , spring acc outer , spring powder , needle valve , oil filter case , base , drive gear , power case , flyweight head gear , idle gear , column assly , contact brush assly , side plate

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government And Public Sector

CTN :39835167

16 Apr, 2025 NA

Chennai - Tamil Nadu

Tender For supply of lab item - qiaamp viral rna mini kit , nuclease free water , kapa hifi hotstart ready mix , qiaquick gel extraction kit , gotaq long pcr master mix , bigdye terminator sequencing buffer , exosap it pcr product cleanup , bigdye terminator sequencing kit , pop 7 polymer , hi di formamide

CTN :39835342

23 Apr, 2025 NA

Kanpur - Uttar Pradesh

Tender For supply of spares for the elevators - microprocessor card 1 ton , sdm card 1 ton , extention card 1 ton , 14 relay card 1 ton , smps 1 ton , contactor 1 ton , single phase preventer 1 ton , voiceannoucement card 1 ton , v3f drive 20 hp 1 ton , breaking resistor 1 ton , brake coil 1 ton , door sensor 1 ton , timing belt 1 ton , reed switch pencil type 1 ton , bi-stable reed switch 1 ton , limit switch 1 ton , inspection box complete 1 ton , brake liner 1 ton , cabin sweep fan with ring and sturd 1 ton , 1 sq mm 12 core travelling cable flat 1 ton , rope sensor 1 ton , osg set-0.63 0.7 1.0 1.5 mps ttc make 1 ton , elevator rope 13 mm fmc 1 ton , auto door cam 1 ton , main pulley 760 mm 1 ton , car guide shoe-16 mm 1 ton , cwt guide shoe 9 mm 1 ton , door operator set 1 ton , ard battery 12 v 18 ah 1 ton , mosfet card 1 ton , charging card 1 ton , 1 pole mcb 1 ton , safety block 1 ton , bottom sill 1 ton , buffer card 1 ton , led car light 1 ton , intercom 1 ton , battery for emergency light alarm 1 ton , lock liver 1 ton , pit switch 1 ton , safety switch 1 ton , thimble 1 ton , safetty rod 1 ton , motor cupple pulley 1 ton , thrust bearing 1 ton , gear box u 800 1 ton , ard tranformer 1 ton , ard contector 1 ton , main transformer 1 ton , osg rope 8 mm 1 ton , encoder 1 ton , timer card 1 ton , diverter pulley 1 ton , buffer spring 1 ton , single pole mcb 1 ton , pg card 1 ton , pulley pedestal plummer block 1 ton , microprocessor card 3 ton , sdm card 3 ton , extention card 3 ton , 14 relay card 3 ton , smps 3 ton , contactor 3 ton , single phase preventer 3 ton , voiceannoucement card 3 ton , v3f drive 30 hp 3 ton , breaking resistor 3 ton , brake coil 3 ton , door sensor 3 ton , timing belt 3 ton , reed switch pencil type 3 ton , bi stable reed switch 3 ton , limit switch 3 ton , inspection box complete 3 ton , brake liner 3 ton , cabin sweep fan with ring and sturd 3 ton , 1 sq mm 12 core travelling cable flat 3 ton , rope sensor 3 ton , osg set-0.63 0.7 1.0 1.5 mps ttc make 3 ton , elevator rope 13 mm fmc. 3 ton , auto door cam 3 ton , main pulley 890 mm 3 ton , car guide shoe 16 mm 3 ton , cwt guide shoe 9 mm 3 ton , door operator set 3 ton , ard battery 12 v 18 ah 3 ton , mosfet card 3 ton , charging card 3 ton , 1 pole mcb 3 ton , safety block 3 ton , bottom sill 3 ton , buffer card 3 ton , led car light 3 ton , intercom 3 ton , battery for emergency light alarm 3 ton , lock liver 3 ton , pit switch 3 ton , safety switch 3 ton , thimble 3 ton , safetty rod 3 ton , motor cupple pulley 3 ton , thrust bearing 3 ton , gear box u 1000 3 ton , ard tranformer 3 ton , ard contector 3 ton , main transformer 3 ton , osg rope 8 mm 3 ton , encoder 3 ton , timer card 3 ton , diverter pulley 3 ton , buffer spring 3 ton , single pole mcb 3 ton , pg card 3 ton , pulley pedestal plummer block 3 ton bid details/ 2 / 102

Bogie Frame Horn Adopter Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors