Latest boroscope Tenders | Government boroscope Tenders

State Government

CTN :39841859

17 Apr, 2025 NA

Varanasi - Uttar Pradesh

Tender For supply of reagents and consumables for sanger sequencer model abi 3500xl - bigdye terminator v3.1 sequencing kit, 100 reaction, bigdye xterminator purification kit.100 preps, bigdye terminator v1.1,v3.15x sequencing buffer ,1ml, high capacity cdna reverse transcripastion kit with rnase inhibitor ,1000rxn, genescane 500 liz standrad 800 rxn, exosap-it clean up kit, 100 rxn, hidi formamide,5mlx4 pack, cathode buffer container, anode buffer container, multicapilliary ds33,8 runs, pop7,960 rxn, conditioning reagents, platinum superfi pcr master mix ,100 reaction, clonejet pcr kit, ro rxn, competent cells 10x100 ul, fix 7 perm medium a,100 ml, fix 7 perm medium b,100 ml, fluorescent primers,10000p moles, pop7,96 rxn, generuler dna ladder lo0bp s0ug fermantas, 6xloading dye solution r0611 mbi fermenta, microamp clear adhesive film, 100 pc, septa 96 well plate, microamp optical 96 wells reaction plate barcoded, superscript vilo cdna synthesis kit

CTN :39846106

17 Apr, 2025 NA

Kolkata - West Bengal

Tender For supply of video boroscope with articulating probe

State Government

CTN :39825597

04 Apr, 2025 NA

Kolkata - West Bengal

Tender For quotation for rt-pcr plates and rt-pcr plate sealer

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39818087

17 Apr, 2025 NA

Secunderabad - Telangana

Tender For supply of video boroscope wireless inspection system as per specification given below:(1) monitor: 3.5" (89mm) tft-lcd wireless colour monitor can be detached from the unit for remote viewing upto 10m with video/image resolution 320 x 240 pixel. (2) camera: transmission range 32.8 feet (10m) clear field, frequency - 2414 mhz, field of view - 60 degeree. (3) a ccessories: heavy duty blow mould case, probe length- standard: 3.28 feet (1 meter), obedient porbe, 2gb micro sd card. (4) extension tools: mirror, magnet, pick-up hook usb cable & av out cable, rechargable battery and ac adapter/charger . [ warranty period: 30 months after the date of delivery ]

State Government

CTN :39699361

07 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For supply of plastiware item - 0.2 ml pcr tube with flat cap, sterile,dnase & rnase free, ultra-thin walls, 0.5 ml microcertrifuge tube,dnase & rnase free, graduated with froasted labelling surface, clear, sterile, 1.5ml microcertrifuge tube,dnase & rnase free, graduated with froasted labelling surface, clear, sterile, 2.0ml microcertrifuge tube,dnase & rnase free, graduated with froasted labelling surface, clear, sterile, 96 well plate semi skirted,sterile,dnase & rnase free, compatible for 3500xl/seqstudio genetic analyzer, 96 well plate semi skirted, sterile, dnase & rnase free, for quantstudio 5 real time pcr system, 15 ml centrifuge tube, dnase & rnase free, graduated with labelling surface, clear, sterile, 50 ml centrifuge tube, dnase & rnase free, graduated with labelling surface, clear, sterile, cryo box for 1.5 ml, more 80 places, tough tag, 1000 spot per roll, filtered micro tip up to 10xl/ 20 l, bulk packed, low retention, sterile, universal tip, dnase & rnase free, filtered micro tip up to 10xl/ 20 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 10 l, bulk packed, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 10 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 20 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 50 l, racked, l w retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 100 l, racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 200 l racked, low retention, sterile, universal tip, dnase & rnase free,, filtered micro tip up to 1000 l racked, low retention, sterile, universal tip, dnase & rnase free,, kimwipes, pack size-280 wipes/pack, disposable latex examination glovess,pack size medium-100pcs,thickness 4 mils or better, disposable latex examination gloves, pack size large-100 pcs, thickness 4 mils or better, nitrile examination gloves (medium size), pack size-100 pcs, thickness 4 mils or better, nitrile examination gloves (small size), pack size-100 pcs, thickness 4 mils or better, nitrile examination gloves (large size), pack size-100 pcs, thickness 4 mils or better, optical adhesive film for realtime-pcr 96 well plates, free of dnase&rnase and human dna, seal integrity from 80 to 110 c, pack size-100 pcs, parafilm dispenser with safety razor/cutter, parafilm m 2-inch x250 ft, 0.2ml pcr tube 96 place rack with cover, micro pipette stand 7 places or more, rack for microcentrifuge tube (1.5/2 ml), 48 places, rack for microcentrifuge tube (1.5ml) 24 places, reversable rack with cover, 96 place, strile disposible petridish 90-100 mm diameter, strile disposible petridish 150 mm diameter, 50ml tube stand (12 places), zero degree mini cooler 12 places, 1.5ml capacity, dna concentration device 0.5ml- volume capacity 0.5ml cutoff 30kda molecular weight high recovery ultracel regenerated cellulose membrane vertical v-shape membrane, device compatible for phenol-chloroform dna extraction process., dna concentration device 4 ml high recovery ultracel regenerated cellulose membrane volume capacity 4 ml cutoff 30kda molecular weight vertical v-shape membrane device compatible for phenol-chloroform dna extraction process. maximum relative centrifugal force (with fixed angle rotor) 14000xg, disposible mask made up of non-woven fabric, triple layered, induvial packed, sterile, disposible head cover, disposable pp non-woven shoe covers, disposible apron, medium size, disposible apron, small size, surgical scissors, stainless steel, rust free, 6" size, surgical scissors, stainless steel, rust free, 8" size, surgical scissors, stainless steel, rust free, 10" size, scalpel holder no. 4, scalpel blade no. 20 ,100 pcs per pack, scalpel blade no. 22,100 pcs per pack, spatuala, stainless steel, rust free, 8" size,

Central Government / Public Sector

CTN :39756122

02 Apr, 2025 NA

Tirupati - Andhra Pradesh

Tender For supply of boroscope-inspection

CTN :39178137

25 Mar, 2025 NA

Cuttack - Odisha

Tender For corrigendum : supply of veterinary care,equipment - cryo apron, cryo boots, forcep for lifting of forzen semen goblets-12'', safety goggles during handling of ln2, alpha french mini empty straw, cryo gloves , artificial vagina 12, artificial vagina 10, latex cone 10.5, collection tube: , flexible tubes for is-4, automatic straw counting machine , ln2 container to store more than 4.70 lacs frozen 0.25 ml bovine semen straws (storage vat of capacity appx 500 liters) , wide mouth container to store more than 3.9 lakh frozen semen straws (storage vat of capacity 390 liters) , goblet 65mm, liquid nitrogen transfer hose pipe( non insulated)-5 mt, flow cytometer, miscroscope stage warmer, electro ejaculator, cryo cautery, cryovial 1.8ml pkt of 100, cryovial 4.5ml,pp, pkt of 100, brucella antibody test kit , digital weighing balance, digital lcd microscope, hot air oven, water treatment plant, refrigerator, "q- pcr (real time) with power back upgel doc system horizontal gel electrophoresis unit with power supplyu.v. spectrophotometer uv trasilluminatormini centrifuge machinewater bath upto1000c", cooling high speed centrifuge( 16000 rpm) with multiple rotors, pcr workstation, automated nucleic acid extraction sysytem, incubator, chemidocumentation imaging system, automatic elisa reader, automatic elisa washers/dispenser, digital ph meter, digital haemoglobinometer, esr analyser, pipette automatic, veterinary hematology analyzer (5 part), veterinary biochemistry analyzer, management system for analyzer operation, veterinary urine analyzer, 100 ml pp bottle with rubber bung &aluminium cup, 300 ml pp bottle with rubber bung &aluminium cup, ss 316 storage tank, capacity-200 lits with accessories, non invasive multiplexed biomass sensor system, peristaltic pump-201v, peristaltic pump-401v, bunsen burner, bod incubator, carbon dioxide incubator, laminar flow, dog ovulation detector, bovine pregnancy rapid test kit, standard nutrient broth (h.s.vaccine medium) lr, thioglycolate broth with liver extract (b.q vaccine medium) - lr , phenyl mercuric nitrate basic (pmn)- lr , potassium aluminium sulfate dodecahydrate - lr, d(+)-glucose,anhydrous (dextrose)-lr, liquid soap, hydrogen peroxide & silver nitrate surface disinfectant -ar, sodium hydroxide palette- lr, rectified spirit-ethyl alcohol-90%, glycerol - 99.5% ar, formaldehehyde solution 37% w/v ar , phenol (carbolic acid) - lr, sodium chloride -lr, peptone- bacteriological- lr, card board box, 3ml glass vial with rubber bung and alluminium cap, micro titre plate, micro titre plate, brookfields viscometer digital rotational viscometer , the leak tester apparatus

CTN :39576212

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For supply of various glass ware and plastic ware items, at skims, soura, srinagar on one year rate contract basis. - item specifications note:- refer to nit for detailed item specifications, glass slides (75x25x1.25), conical glass flask (250ml), conical glass flask (500 ml), conical glass flask (1000 ml), conical glass flask (2000 ml), cylindrical flask 500ml, microtips (100 1000 l), microtips (0.5 - 10 l), micropipette tips (10 100 l), micropipette tips (20 - 200 l), glass funnels (large), glass funnels (small), glass funnels (medium), measuring cylinder (1000ml), measuring cylinder (500ml), measuring cylinder (250 ml), measuring cylinder (100ml), measuring cylinder (50ml), measuring cylinder (10ml), micropipette (variable) 100-1000 l, micropipette (variable) 1 10 l, micropipette (variable) 20 200 l, micropipette variable (0.2 2 l), micropipette variable (10 100 l), automatic pipette (10 100 l ), automatic pipette (100 l 1000 l), multichannel micropipette (100 1000 l) 8 channel, multichannel micropipette (2 l 20 l ) 8 channel, multichannel micropipette (30 l 300 l) 8 channel, multichannel micropipette (10 l 200 l ) 8 channel, microfuge tubes 1.8ml, microfuge tubes 1.5ml, tri-sodium citrate tubes (double sandwich) 1.8ml, blood collection tubes with edta k2 tubes with following specifications:1. capacity 2ml2. should have k2 coated in dried form.3. cap should have leak proof rubber cap with needle pierceable & plastic shield., blood collection tubes with clot activator, sodium floride tubes, urine processing tubes 10ml, sterile plastic urine containers 50ml, pasture pipettes with teets, cell counters, neubar chamber (improved), filter paper grade 1medium flow 11 m thick, dimensions: 460mm x 570mm, filter paper (410 r) ashless, digital ph meter, thermometers (for waterbath upto 100oc ), forceps (disecting) 6 inches, cover slips (22x22mm), cover slips (22x40mm), charged slides (22x40mm), cover slips (18x18mm), slide carrying trays aluminum 30x20cms with lock clips, slide drying rack (15x25 cms), glass beaker 1000 ml, glass beaker 500ml, glass beaker 250 ml, glass beaker 100 ml, glass beaker 50 ml, glass beaker 10ml, metal enamel tray 30x35 cms, staining racks (triangular slide with tapered top), staining dish (glass), slide staining rectangular bars stainless steel 36cm length, comet dropping bottles 60ml plastic material, tube holding rack with the capacity to hold 100 tubes, pcr tubes (0.2ml), polypropylene conical tubes 15ml (falcon tubes), polypropylene conical tubes 50ml (falcon tubes), plastic stand for 15ml conical tubes, plastic stand for 50 ml conical tubes, plastic droppers (5ml), terrasaki plates for hla typing, aluminum chambers for patch testing, tip boxes for 10 l tips, tip boxes for 100 l tips, tips boxes for 1000 l tips, racks for holding 0.2ml pcr tubes, pipette stand for micropipettes, culture bottles flat type (sterile 100ml), discard jar 5 ltr., reagent bottle with screw cap autoclavable (1000 ml), reagent bottle with screw cap autoclavable (500 ml), reagent bottle with screw cap autoclavable (250 ml), reagent bottle with screw cap autoclavable (200ml), reagent bottle with screw cap autoclavable (100 ml), dilution bottles 500ml, gastric lavage bottles 200ml plastic, evidence bag 12 x 16 , animal cell culture media bottle 250ml, epindrof tubes (micro tubes) 1ml, gluco meter pen, blood glucose monitoring strips (successful bidder will have to provide one gluco meter free of cost with every 1000 strips). , multi sticks for urine examination, blood lancets, ph tablet 4.0, ph tablet 7.0, ketone meters, ketone strips, biochemistry disposable cuvettes, assorted racks, autoclavable mesh baskets (medium size), cryovials (1.8ml) screw cap sterile, multipurpose stands (plastic), petri dishes 90mm plastic (autoclavable), storage vials screw caped (2ml), two quadrant petri plates 90mm autoclavable, microtiter plate (round bottom), sterile swabs (plastic), swab bowls, culture vials glass 30ml, culture vials glass 15ml, gl

Boroscope Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

State Government

Central Government/Public Sector

Central Government / Public Sector

State Government

Central Government / Public Sector