Latest deltramethrin Tenders | Government deltramethrin Tenders

corporations/Associations/Others

CTN :38988703

31 Mar, 2025 64.31 Lacs

Bangalore - Karnataka

Tender For bid to ras supply of drugs - solution oral caffiene , inj caffiene citrate , inj hyaluronidase 1500iu freeze dried powder , injection cerebrolysin 215.2mg per ml , injection hyaluronidase 48mg 6ml , inj hyaluronidase 3% wv 90mg 3ml penfilled syringe , inj magnesium sulphate 5opercentage , hypromellose opthalmic solution 2% w/v , inj sodium hyaluronate opthalmic solution 1.6% w/v , inj trypan blue solution 0.06%w/v , inj lorazepam 2mg/ml , inj haloperidol 5mg/ml , spray benzocaine 0.36% w/w + cetrimide 0.5%w/w , inj actinomycin d 0.5mg , inj degarelix 120mg , inj degarelix 80mg , inj doxorubicin 50mg , inj eribulin 0.5mg , inj irinotecan 100mg , inj irinotecan 40mg , inj leuprolide 22.5mg , inj doxorubucin 20mg , inj oxaliplatin 100mg , inj darbapoietin alpha 500mcg , inj multiple electrolyte solution 500ml bag , inj botilinium toxin 100iu , inj l-ornithine l-aspartate infusion 5mg/100ml , inj phenylephrine 10mg/ml , inj pralidoxime iodine 500mg 25mg/ml , 500mg in 20ml , inj romiplastin 500mcg/ml , inj doxycyclin 100mg , iv normal saline 500ml glass bottle 0.9% w/v , iv sterile water 500ml , iv ringer lactate 500ml glass bottle , inj buprenorphine 0.3mg/ml , inj clonidine 150mcg/ml , inj ephedrine 30mg/ml , inj etomidate 2mg/ml , inj hydroxyethylstarch 500ml , inj lignocaine 4% , inj mephentaramine 30mg/ml , inj glycopyrrolate 0.5mg + neostigmine methylsulphate 2.5mg , inj thiopental 1gm , 3.5% colloidal infusion of polygeline with electrolytes for iv administration 500ml , iv sevoflurane , spray lidocaine 10% , inj ropivacaine 0.25% , inj ropivacaine 0.75% , inj vecuronium 10mg/puff , inj ketamine 50mg/ml , inj nalbupine 10mg/ml , transdermal patch fentanyl 12.5mcg , transdermal patch fentanyl 25mcg , aminoacid solution 10% for intravenous infusion

CTN :39846983

17 Apr, 2025 NA

Belgaum - Karnataka

Tender For supply of drug and medicine - chlordiazepoxide 10mg tab , doxepin 25 mg cap , clomipramine hcl 25 mg tab , clozapine 100 mg tab , duloxetine 20 mg tab , doxepin hcl 75 mg cap , fluoxetine hcl 20 mg cap , haloperidol 5 mg tab , lorazepam 1 mg tab , lithium carbonate 300 mg cap tab , clonazepam 0 point 25 mg tab , clozapine 25 mg tab , desvenlafaxine 50 mg tab , etizolam 0 point 5 mg tab , risperidone 2 mg tab , aripiprazole 10 mg tab , atomoxetime 10 mg tab , olanzapine 10 mg tab , venlafaxine 75 mg tab , sertraline 50 mg tab , zolpidem 10 mg tab , quetiapine 50 mg tab , paroxetine xr 12 point 5 tab , tab amisulpride 200 mg , quetiapine 25 mg tab , sertraline 100 mg tab , glycopyrronium 25 mcg smartules , etophylline bp 84 point 7mg theophylline 25 point 3 per ml 2 ml inj , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per cfc free mdi , cap nintedanib 150 mg , cap nintedanib 100 mg , levosalbutamol sulphate 2 point 5 ml containing 1 point 25 mg respule , tiotropium bromide 9 mcg 120 metered doses unit inhaler , tiotropium bromide 18 mcg formoterol 12 mcg dry powder cap , budesonide 200 mcg dry powder , formoterol 12 mcg fluticasone 250 mcg dry powder , tiotropium bromide 18 mcg dry powder cap , terbutaline 1 point 25 mg bromhexine 4 mg guaiphenesin 50 mg per 5 ml bott 100 ml syp , dextrose 5 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , sterile water for amp of 10 ml , tab cap mirabegron 25 mg , silodosin 4 mg tab , anti phlebitis cream tube of 15g 20g , povidone iodine 10 percent solution bott of 100 ml , enteral feed pdr protein 85 peptides 15 fat 50 mct 25 85 15 50 25 percent sachet 126 gm , cilostazole tab 100 mg , sildenafil citrate 50 mg tab , tolteridone tartrate 2 mg tab , drotaverine hcl 40 mg tab , finasteride 5 mg tab , vitamin b complex vit b1 5mg vit b6 3mg vit b12 5mcg therapeutic tabcap , vitamin b 12 500 mcg ml inj , iron syp paediatric 5 ml elemental iron 25 50 mg folic acid 500mcg bottle of 200ml , multi vit inj iv thiamine 30mgml pyridoxine 30mg ml cyanocobalamin 300 mcgml 2 to 10ml , dapaglifozin 5 mg tab , fluticasone propionate inhaler for adults 125 mcg dose , salmetrol 50mcg fluticasone 250mcg pdr 30 60 100 doses pdr inhaler , colchicine 0 point 5mg tab , capsacain gel tube of 20 gm , glucosamine 250mg chondroitin sulphate 200 mg cap , ibuprofen gel tube of 20 gm , leflunomide 10 mg tab , nimesulide gel tube of 20 gm , methylprednisolone 4 mg tab , clindamycin 300 mg cap , sulphamethoxazole 400 mg trimethoprim 80mg tab , acyclovir 200 mg tab , emtricitabine 200 mg tenofovir 300mg tab , lamivudine 150 mg tab , efavirenz 600 mg tab , zidovudine tab 300 mg , zidovudine 300mg lamivudine 150mg nevirapine 200mg tab , nitrofurantoin 100 mg cap , clozapine 50 mg tab , bisoprolol 2 point 5mg tab , carvedilol 6 point 25 mg tab , olmesartan 20 mg tab , propanolol 10 mg tab , trimetazidine mr 35 mg tab , gliclazide 40 mg tab , voglibose 0 pont 3 mg tab , tab ornidazole 500 mg , tenofovir 300 emtricitabine 200mg efavirenz 600mg tab , hepatitis b vaccine 10 ml , cell culture rabies vaccine vial of 1 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml , syp iron with vitamin b12 and folic acid bott of 200 ml , syp lactulose each 5ml containing 3 point 325g bott of 200ml , syp liquid paraffin 1 pont 25 magnesium hcl 3 point 75 sodium picosulphate 200 ml bott , syp multivitamin multiminerals bott of 200 ml

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39498757

28 Mar, 2025 NA

Ganganagar - Rajasthan

Tender For bid to ras bid to ras tender for supply of pramipexole 0 point 5 mg tab , prasugrel 10 mg tab , prasugrel 5 mg tab , prazocin sr 2 point 5 mg tab , prazocin sr 5 mg tab , prednisolone 20 mg tab , prednisolone 5 mg tab , pregabalin 75 mg plus nortriptyline 10 mg tab , pregabalin 75 mg plus methylcobalamin 1500 mg tab , pregabalin 75 mg , pre probiotc tab , propranolol 10 mg tab , propranolol 20 mg tab , propranolol tr 40 mg tab , protein powder pack or tin of 200 gm , quetiapine 50 mg tab , rabeprazole 20 mg tab , rabeprazole 20mg plus itopride 50mg tab , rabeprazole 20 mg plus domperidone 30 mg sustained release tab , ramipril 10 mg tab , ramipril 2 point 5 mg tab , ramipril 5 mg tab , ranitidine hcl 50 mg amp of 2 ml inj , repaglinide 0 point 5 mg tab , respule levosalbutamol 1 point 25 mg in 2 point 5 ml , rifaximin 550 mg tab , ripasudil 0 point 4 percent w by v bott of 5 ml eye drops , risperidone 1 mg tab , risperidone 2 mg tab , risperidone 4 mg plus trihexephenedyl 2 mg tab , rivoraxaban 20 mg tab , roller bandage open woven uncompressed 10 cm x 4 metres , roller bandage open wove uncompressed 6 cm x 4 metres , rosuvastatin 10 mg plus fenofibrate 160 mg tab , rosuvastatin 10 mg tab , rosuvastatin 20 mg tab , rosuvastatin 40 mg tab , rotacap salmeterol 50 mcg plus fluticasone 250 mcg , rotahaler , saccharomyces boulardii 250 mg cap , sachet pre probiotic fructooligosaccharide plus bifidobacterium plus streptococcus plus lactobacillus , salbutamol 200 mdi each metered dose supplies 100 mcg of salbutamol mdi , salmeterol 50 mcg plus fluticasone propionate 250 mcg seretide accuhaler , saroglitazar 4 mg tab , sertraline 50 mg tab , sevelamer 400 mg tab , sgot kit erba , sgpt kit erba , silodosin 4 mg tab , silodosin 8 mg cap , silver sufadiazine oint 1 percent tube of 20 gm , sitagliptin 50 mg tab , sitagliptin 50 mg tab plus metformin 1000 mg tab , sitagliptin 50mg tab plus metformin 500mg tab , sodium bicarbonate 1000 mg tab , sodium bicarbonate 500 mg tab , tab sodium valproate 300 mg cr , solifenacin 10 mg tab , spironolactone 25 mg tab , spironolactone 50 mg , sucralfate suspension 1gm per 5ml bott of 200 ml , sulphacetamide 20 percent w by v eye drops amber bottle with self dropper bott of 10 ml , sulphasalazine 1 gm tab , sumitriptan 50 mg tab , syp iron with vitamin b12 and folic acid bottle of 200 ml , syp paracetamol 162 mg plus ibuprofen 100 mg 60 ml suspension , syp cyproheptadine hcl 2 mg per 5 ml bott of 100 ml , syp potassium citrate 1100mg plus citric acid or magnesium citrate 300 to 400mg per 5 ml bott of 100 ml , syp tricholine citrate 0 point 55 mg plus sorbitol 7 point 15 gm per 10 ml bott of 200 ml , syringe disposable sterile 10 ml with needle , syringe disposable plastic 20 ml with needle , syringe disposable plastic sterile 2 ml with needle , syringe disposable plastic 3 ml with needle , syringe disposable plastic sterile 5 ml with needle , tadalafil 5 mg tab , tamsulosin 0 point 4 mg plus dutasteride 0 point 5 mg tab , tamsulosin 0 point 4 mg tab , taurine 500 mg plus acetylcystine 150 mg tab , telmisartan 20 mg tab , telmisartan 80 mg tab , telmisartan 40 mg plus hydrochlorothiazide 12 point 5 mg tab , teneligliptin 20 mg plus metformin 500 mg tab , teneligliptin 20 mg tab , tennis elbow support , tenofovir alafenamide 25 mg tab , terbinafine 250mg tab , terbinafine 1 percent cream tube of 10 gm , thalidomide 50 mg tab , thiocolchicoside 4 mg tab , thyroxine 100 mcg tab , thyroxine 12 point 5 mcg , thyroxine 125 mcg tab , thyroxine 150 mcg tab , thyroxine 25 mcg tab , thyroxine 50 mcg tab , thyroxine 75 mcg tab , timolol maleate 0 point 05 percent eye drop bott of 5 ml , tinidazole 500 mg tab , tiotropium 18 mcg rotacap , tiotropium bromide 9 mcg 120 metered doses per unit inhaler , tofacitinib 5 mg tab , tolperisone sr 150 mg tab , tolterodine 2 mg tab , tolterodine 4 mg tab , tolvaptan 15 mg tab , torsemide 100 mg tab , torsemide 10 mg plus spironolactone 50 mg tab , torsemide 10 mg tab , torsemid

Central Government/Public Sector

CTN :39562406

27 Mar, 2025 5.34 Crore

Paradip - Odisha

Tender For corrigendum : supply of "albendazole 200mg, 10 ml. bottle " , di-sodium hydrogen citrate 1.37g/5ml. pack of 100ml. , amoxicillin 200 mg,clavulanic acid-28.5 mg/5ml.bottle of 30ml , sucralfate1gm,oxetacaine 20mg/10ml. bottles of 170ml , aluminium hydroxide 200 mg,mg. hydroxide 200 mg. per 5ml sugar free liquid bottle packing of 170ml. , "dicyclomine 10mg./5ml. pack of 30ml " , "ambroxol 30mg,guaiphenesin 100 mg,terbutaline 2.5 mg/10ml syrup, bottles of 100ml. " , "dextromethorphan 10 mg ,phenylephrine 5 mg ,chlorpheniramine meleate 2mg/5ml syrup,bottles of 100ml. " , "azithromycin 200mg/5ml syrup/suspension ,bottles of 15ml. " , magnesium hydroxide 3.75 ml,liq. paraffin 1.25 ml, sodi. pico sulphate 3.33 mg bottles of 225ml. , "lactitol monohydrate 10 gm syrup/suspension pack of 200ml, " , "cetirizine 5 mg/5ml syrup/suspension bottles of 60ml." , "ondansetron 2 mg/5 ml syrup/suspension, bottles of 30ml. " , "paracetamol 250 mg/5 ml syrup/suspension, bottles of 60ml." , "montelukast 4mg, levocetrizin 2.5mg/5ml syrup/suspension bottles of 30ml." , "ambroxol 15 mg,guaifenesin 50 mg,terbutaline 1.25 mg 5ml syrup, bottles of 100-mlpadeiatric " , ofloxacin 100mg,metronidazole 200mg syrup, bottles of 60ml. , "ibuprofen 100mg,paracetamol 125mg/5ml syrup/suspension bottles of 30 ml" , "calamine and zinc oxide lotion... bottles of 100ml " , "beclomethasone dipropionate 0.025% w/w,phenylephrine hydrochloride 0.10% w/w,lignocaine hydrochloride 2.50% w/w,chlorocresol 0.1% w/w, pack of 20gm. " , povidone -iodine 2%w/v germicide gargle, pack of 100 ml bottle , chlorhexidine gluconate 0.2 %w/v mouth gargle , clotrimazole 1% w/w,beclomethasone 0.025% w/w (tube) pack of 15gm , "clindamycin 1% w/w,pack of 20gm " , "diclofenac 1.16, linseed oil -3,menthol 5,methyl salisylate 10,capsaicin 0.025...pack of 30 gm " , "diclofenac diethylammonium topical ,linseed oil topical... " , clobetasol 0.05%,miconazole 2%,tube of 15 gm packing , clobetasol 0.05%,salicylic acid 6%,tube of 30 gm packing , mometasone furoate 0.1% w/w (tube), pack of 15gm. , mometasone 0.1% w/w , fusidic acid 2% w/w (tube), pack of 10gm. , "triamcinolone acetonide 0.01 %w/w, pack of 5-10gm " , "ammonium chloride 0.5 %w/w,calcium lactate 0.5 %w/w,glycerin 3 %w/w,lactic acid 6 %w/w,magnesium chloride 0.3 %w/w,potassium chloride 0.5 %w/w,sodium chloride 0.5 %w/w,sodium dihydrogen phosphate 0.5 %w/w,urea 12 %w/w,ointment/cream " , "octinaxate,oxybenzone,zinc, avobenzone (spf 50) lotion pack of 50gm " , liquid paraffin 10.2 %w/w,white soft paraffin 13.2 %w/w gel/cream, pack of 100gm , "terbinafine 1% w/w powder, pack of 50-100gm " , "ketoconazole 2% w/w soap pack of 50-100gm " , ketoconazole shampoo 2% w/v pack of 60ml. , "itraconazole dusting powder 1% w/w, pack of 30-100gm " , luliconazole 1w cream/gel, pack of 50 gm , acyclovir 5% w/w cream, pack of 5gm , chloramphenicol 10 mg,polymycin b sulphate 10000 iu,dexamethasone 1 mg/1 gm ointment, pack of 5gm , "neomycin 3400 u,polymycin b 5000 u,bacitracin 400 u ointment, pack of 5-10gm " , chloramphenicol 10 mg,polymyxin-b 10,000 iu/1gm ointment, pack of 5gm , silver nitrate 0.2% w/w gel/cream (tube), pack of 10-30gm , silver nitrate 0.2% jar of 240 gms packing , ganciclovir 1.5mg/1gm w/w ophthalmic gel, pack of 5gm , "chlorhexidine 0.25%,metronidazole 1%/ gm gel, pack of 20-30gm " , "lignocaine 2% w/w gel (tube)with nozzle, pack of 30-60gm " , mupirocin 2% w/w ointment, pack of 5gm , "prilocaine 2.5% w/w,lidocaine 2.5% w/w oint. (tube), pack of 5gm to 30gm " , clotrimazole 1% w/v/ml lotion, pack of 15 ml , "clotrimazole 1% w/v,beclomethasone 0.025% w/v/ml lotion, pack of 15-30ml " , permethrin lotion 5% w/w, pack of 50-100ml , salbutamol 2.5mg./ml respule pack of 2.5 ml , salmeterol 25mcg,fluticasone 250mcg/puff , pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg,budesonide 200mcg/puff, pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg, budesonide 400mcg/puff, pack of 120 metered dose with dose count

CTN :39774494

12 Apr, 2025 44.7 Thousand

Purba Medinipur - West Bengal

Tender For supply of torsemide 10 mg tab , loperamide 2 mg tab , sumatriptan 50 mg tab , chlordiazepoxide 5 mg plus clidinium 2 point 5 mg tab , promethazine syp 5mg per 5 ml bottle of 60 ml , digoxin 0 point 5 mg 2ml injection , prochlorperazine mesylate injection , paracetamol with cysteine hcl monohydrate infusion 1000 mg per 100 ml , ivabradine 2 point 5 mg tab , cilnidipine 5 mg tab , ranolazine 500 mg tab , diltiazem 60 mg tab , pioglitazone hydrochloride 15 mg tab , sodium bicarbonate 500 mg tab , nasal decongestant adult drops xylometazoline hcl 0 point 1 percentage w per v nasal drop bottle of 10 ml , corn cap , isabgol husk 3 point 5 gram , trypsin with chymotrypsin tab , disodium hydrogen citrate syrup , calcium 9 mg plus calcium gluconate 50 mg inj for iv use 10 ml injection , amiodarone hcl 150 mg 3 ml inj , heparin 5000 iu per ml inj , atropine sulphate 0 point 6 mg 1 ml inj , paracetamol 150 mg per ml 2 ml iv inj , dexamethasone sodium phosphate 4 point 4 mg equivalent to dexamethasone phosphate 4 mg per ml 2 ml inj , dextrose 25 percentagew 25 ml inj , dobutamine hcl 250 mg 5 ml inj , metoclopramide hcl 5 mg per ml 2 ml inj , inj nitroglycerine 5 mg , tranexamic acid 500 mg tab , carvedilol 3 point 125 mg tab , digoxin 0 point 25 mg tab , nebivolol 5 mg tab , trihexyphenidyl hcl 2 mg tab , entacavir 0 point 5 mg tab , northisterone acetate 5 mg tab , magnesium sulphate 50 percentaged w per v inj , thyroxine sodium 75 mcg tab , thyroxine sodium 50 mcg tab , etophylline 84 point 7mg plus theophylline 22 point 3mg per ml 2 ml inj , sodium bicarbonate 7 point 5 percentage amp of 10 ml , inj thiamine 100 mg per ml 2 ml amp , lorazepam 1 mg tab , diazepam 10 mg 2 ml inj , haloperidol 5 mg per ml inj , rasagiline 1 mg tab , flunarizine 5 mg tab , carbidopa 10 mg plud levodopa 100 mg , quetiapine 25 mg tab , pyridoxine 40 mg tab , microtips size 0 to 200 micro litere packet of 1000 , leflunomide 20 mg tab , bromhexine syp 4 mg per 5 ml bottle of 100 ml , liquid paraffin 3 point 75 mg plus milk of magnesia 11 point 25 mg bottle of 170 ml

CTN :39776689

28 Mar, 2025 1.83 Lacs

Tiptur - Karnataka

Tender For supply of drugs, chemicals and consumables to gh tiptur - ferrous salts (a) +folic acid (b) 20mg elemental iron (a) +100mcg (b)20 mg + 100 mcg ip/bp/usp(1x10x10) _tipturgh, adrenaline bitartrate1mg/ml injection_tipturgh, amikacin500mg/2ml injection_tipturgh, amitriptyline25mg (1x10x10)_tipturgh, amoxicillin+clavulinic acid625mg(1x10x10)_tipturgh, amoxicillin+clavulinic acid 200mg+28.5mg/5ml drysyrupx 30ml_tipturgh, amoxycillin powder 125mg/5mldrysyrupx60ml_tipturgh, amoxycillin powder 250mg/5mldrysyrupx60ml_tipturgh, anti-d immunoglobin (human)300mcg injection_tipturgh, antisnake venom (polyvalent lyophilized)_tipturgh, atenolol50mg(1x10x10)_tipturgh, atorvastatin100mg(1x10x10)_tipturgh, atropine sulphate1mg/ml injection 1ml_tipturgh, calcium carbonate with vitamin d3500mg+250iu (1x10x10)_tipturgh, cefotaxime1 gm ip/bp/usp injection_tipturgh, ciprofloxacin hydrochloride500mg(1x10x10)_tipturgh, ciprofloxacin hydrochloride eye/ear0.3%w/v x 5ml eyedrop_tipturgh, dexamethasone4mg/mlinjection 2ml_tipturgh, dextrose5%w/v infusion x 500ml_tipturgh, dextrose with sodium chloride5% + 0.9% w/v x 500ml infusion_tipturgh, diclofenac25mg/ml injection 1ml_tipturgh, diclofenac25mg/ml injection 3ml_tipturgh, dicyclomine hydrochloride10mg/ml injection_tipturgh, diptheria and tetanus vaccine .5ml injection_tipturgh, dopamine hydrochloride40mg/ml5ml injection_tipturgh, frusemide10mg/ml x 2ml injection 1x2ml_tipturgh, glimepiride2mg(1x10x10)_tipturgh, glyceryl trinitrate (sublingual)0.5mg(1x10x10)_tipturgh, hydrocortisone sodium succinate100mginjection5ml_tipturgh, iron sucrose 100mg/5ml injection 1x5ml_tipturgh, ketamine hydrochloride10mg/mlinjectio x10ml _tipturgh, labetolol100mg(1x10x10)_tipturgh, labetolol5mg/ml injection5ml_tipturgh, levo cetrizine5mg (1x10x10)_tipturgh, lignocaine hydrochloride with adrenalin(1x30ml)2% w/v+.001%w/v injectionx30ml_tipturgh, lignocaine hydrochloride(1x30ml)2% w/v injectionx30ml_tipturgh, magnesium sulphate500mg/mlinjection1x2ml_tipturgh, mannitol20% x100ml infusion_tipturgh, metronidazole400mg (1x10x10)_tipturgh, metronidazole500mg/100ml infusion x100ml_tipturgh, metronidazole200mg/5mlsyrup 60ml_tipturgh, misoprostol200mcg(1x10x10)_tipturgh, ondansetron2mg/mlinjectionx2ml_tipturgh, oral rehydration saltssodium cloride 2.6,glucose anhydrous 13.5,potassium cloride 1.5,trisodium citrate dihydrate 2.9 powder 10gm sachet_tipturgh, oseltamavir75mg(1x10x10)_tipturgh, oseltamavir12mg/mlsyrupx100ml_tipturgh, oxytocin5iu/mlinjection x1ml_tipturgh, omeprazole capsules 20mg(1x10x10)_tipturgh, paracetamol500mg(1x10x10)_tipturgh, paracetamol650mg(1x10x10)_tipturgh, paracetamol125mg/5mlsyrup x60ml_tipturgh, paracetamol250mg/5mlsyrupx60ml_tipturgh, paracetamol100mg/5mldropsx15ml_tipturgh, paracetamol1% w/v/100mlinfusion x100ml_tipturgh, paracetamol suppository170 mg1x5_tipturgh, paracetamol suppository80 mg1x5_tipturgh, pheniramine maleate22.75 mg/mlinjection1x2ml_tipturgh, pralidoxime chloride(2- pam)1g injection_tipturgh, premix insulin 30 is to 70 1x10ml40iu/mlinjection1x10ml_tipturgh, propofol1% oil suspension1% oil suspension1x10ml_tipturgh, rabies vaccine2.5iuinjection 1x0.mlwithdiluent1x1ml, rabies immunoglobin 1x2ml150iu/mlinjectionx2ml_tipturgh, ranitidine25mg/mlinjection 1x2ml, ringer lactateas per ip infusion 1x500ml_tipturgh, salbutamol nebuliser5mg/mlinhalation solution 1x15ml_tipturgh, sodium chloride (normal saline)0.9%w/v x500ml infusion 1x500ml_tipturgh, sodium chloride(normal saline)0.9%w/v x100mlinfusion 1x100ml_tipturgh, vecuronium4mginjection 1x2ml_tipturgh, vitamin k iv1mg/0.5mlinjection 1x1ml_tipturgh, zinc sulphate20mg(1x10x10)_tipturgh, zinc sulphate20mg/mlsyrup1x60ml_tipturgh, absorbent cotton wool1x500 gm_tipturgh, blood transfusion set 1x1_tipturgh, calamine lotion 100ml 1x100ml_tipturgh, endotracheal tubess with cuff (pvc)(sterile)_tipturgh, hbsag_tipturgh, infant feeding tubes6f _tipturgh, infant feeding tubes8f _tipturgh, plaster of paris bandage (isi/iso/ce)15cmx2.7mts _tipturgh, ryles tubess1

CTN :39786118

26 Mar, 2025 95.00 Lacs

Phalodi - Rajasthan

Tender For corrigendum : e tender for lab items - drabkin solution for hb estimation, tlc dilueting fluid, tlc pipette, dlc diluting fluid, dlc pipette, platelate count fluid, esr pipette disposable, anti a sera, anti b sera, anti d sera ( igg & igm), anti human globulin ( coombs reagent), normal saline, test tube glass 12 x75, test tube glass 12x100, droper plastic, slide pkt iso mark, cover slips 18x18, giemsa stain, leishman stain, paraffin oil, slide tray aluminum, distilled water, methanol, reticulocyte count fluid, methylene blue soln, brilliant cresyl blue soln, eosinophill count fluid, hemocytometer ( counting chamber ), bt ct capillary, filter paper, stop watch/timer, alcohol swabs, sickling test for sickle cell anemia, sickling rapid test for sickle cell anemia, nestroft test for screening of thalessemia, dcip for screening for hbe hemoglobinopathy, quantitative test g6pd deficiency, malaria rapid card test, pt reagent, sodium citrate tube for pt test, aptt reagent, calcium chloride soln, hcg ( pregnancy card), urine strips for ph,sg,tlc,glu,bil,uro,ketone,protein,nitrate, urine container plastic 30ml, test tube disposable plastic 12x100 ( 4 " ), urine strips for microalbumin, urine strips for acr, test kit for stool for ova and cyst, test kit for occult blood, semen diluting fluid, dengue rapid card test (igg,igm & ns1 ag combo), typhoid card test antibody, rpr /vdrl test for syphilis ( rapid card tests), rapid test card for the simultaneous detection of malara pv/pf antigen, s.thphi ( igm antibodies) and dengue ns1 antigen from a single card ( combo), hiv rapid card test with single step procedure ( serum and plasma), hbsag rapid card test 0.1 iu/ml senstivity, anti hcv rapid card test, rapid test card for the simultaneous detection of hiv 1& 2,hcv,hbsag ,syphilis from a single card ( combo), afb stain kit, widal test kit, blood sugar kit, gtt test kit, bilirubin total & direct kit, creatinine kit, urea test kit, uric acid test kit, sgpt test kit, sgot test kit, alkanine phosphate test kit, total protein test kit, albumin test kit, globulin test kit, total cholesterol test kit, triglycerides test kit, vldl direct test kit, hdl direct test kit, ggt test kit, amylase test kit, iron test kit, tibc test kit, hba1c test kit, s.calcium kit, s.magnesium test kit, acid phosphatest test kit, grams stain soln, thorat swap for diphitheria, visual inspection acetic acid, rk 39 for kala azar by rapid card test, smear for filaria, montex test 5tu, montex test 10tu, tuberculin syring for montex test, troponin i rapid card test, trop t rapid card test, ra quantitative test kit, crp quantitative test kit, aso quantitative test kit, blue tips, clot activator non vaccum tube double cap, edta nonvaccum tube double cap, jsb stain 1, jsb stain 2, keto stix, lugol iodine, methanol 5ltr, microscope bulb, printer paper roll 57mmx10mtr, printer paper roll 57mmx20mtr, sodium citrate soln, sodium hypochlorite soln, tissue paper roll, urine strips 04 parameter, yellow tips, electrolyte analyzer as per enclsoed technical specifications, 5 part hematology analyzer as per enclosed technical specifications, fully automated immunoassay analyzer ( clia) as per enclosed technical specifications, semi automated bioschemistry analyzer as per enclosed technical specifications

State Government

CTN :39391119

01 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For corrigendum : online tender for the rate contract and supply of pharmaceuticals to various hospitals of government of madhya pradesh for a period of 18 months - drugs, acyclovir 3%(ointment),ointment, alfacalcidol 0.25mcg, calcium 200mg (0.25mcg+200mg),capsule, alfuzosin (10mg),tablet /capsule, amantadine (100mg),tablet, amisulpride (50 mg),tablet, anti d immunoglobulin for iv/im use (monoclonal) (150mcg (1ml vial)),injection, anti thymocyte globulin (250mg/5ml),injection, atorvastatin + asprin (10mg + 75mg),tablet or capsule, bisoprolol (5 mg),tablet, busulphan(60mg/10ml),injection, canagliflozin (100 mg),tablet, carbamazepine(100 mg / 5ml 100ml bottle),syrup, chlorthalidone (12.5mg ),tablet, clobetasole propionet 0.05% + salicylic acid 3% (15gm tube),ointment, cyclosporine (100mg),capsule, cyclosporine(100mg/ ml),solution, cyclosporine(50mg),capsule, dacarbazine 200mg (10mg/ml),injection, diclofenac+paracetamol+chlorzoxazone (50mg + 325mg + 250mg),tablet, diloxanide furoate (tablet 500 mg),tablet, etophylline + theophylline sr tablet 231mg + 69mg,tablet, fat emulsion 20% (250ml),injection, ferric carboxymaltose 50mg/ml(20ml vial),injection, fluvoxamine (100mg),tablet, fluvoxamine (50mg),tablet, formoterol 6mcg + budesonide 400mcg (30 cap x 6 pack with 1 dispensing device),rotacaps, gatifloxacin (0.3% ),eye drop, glargine 100 iu /ml, 3ml cartridge inj. (firm has to supply one compatible pen with every 20 cartridges as and when required without any extra cost)(100 iu /ml),cartridges, glimepride 2mg + metformin 1000mg (tab),tablet, hepatitis b immunoglobulin (100 iu/vial),vial, human insulin regular/soluble (100iu/ml (10ml vial)),injection, hydrocortisone sodium succinate inj. 200mg vial,injection, hydroquinone 2% + mometasone 0.1% + tretinoin0.025% (5 gm tube),cream, hydroxy propyl methyl cellulose injection 2% (3ml prefilled syringe),syrings, ipratropium bromide inhaler 20mcg per puff (200 metered dose container),inhaler, irinotecan hydrochloride (100mg),injection, labetalol 5mg/ml (4ml ampl),injection, lactulose (10gm/15ml (100 ml bottle)),solution, lamotrigine dt tab (100mg),tablet, levetiracetam 100mg/ml syrup/ solution (100ml bottle),syrup, lorazepam (2 mg),tablet, magnesium sulphate injection (50 % w/v 10ml amp),injection, medroxyprogesterone acetate (injection 150 mg 1ml/vial),injection, moxifloxacin ( 400mg),tablet, nepafenac(1mg/ml),eye drop, nicotine (nrt) (2 mg chewing gum ),gum, nicotine (nrt) (4 mg chewing gum ),gum, pancreatin 170 mg+oxbile extract 50 mg + ginger oleoresin 2 mg+activated charcoal 50 mg(tab)(tablet (with additional content acceptable)),tablet, phenobarbitone (200 mg/ml),injection, potassium chloride 150mg/ml injection, 10ml ampoule (10ml ampoule),injection, pregabalin (75mg),capsule, rabeprazole + levosulpiride (20mg +75mg),tablet or capsule, rifaximin (400mg),tablet, sitagliptin (100mg),tablet, sitagliptin + metformin (50mg + 500mg),tablet, sodium hyaluronate (intraocular) (1% /ml),injection, sorafenib (200mg),tablet, tenecteplase (40mg),injection, tenecteplase 20mg (20mg),injection, teneligliptin (20mg),tablet, thyroxine sodium (75 mcg),tablet, tiotropium 9 mcg + formoterol 6 mcg + ciclesonide 200 mcg (pack of 180 to 200mdi),inhaler, tiotropium 9mcg 180 doses inhaler (180 or more doses acceptable),inhaler, tricholine citrate + sorbitol (550mg + 7.15 g/10ml ),syrup, vinblastine (10mg),injection, vitamin d3 (800iu/ml),drop, voglibose (0.2 mg),tablet, water for injection 5ml amp

Deltramethrin Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

corporations/Associations/Others

Central Government/Public Sector

Central Government/Public Sector

State Government