Latest disinfection mask Tenders | Government disinfection mask Tenders

Central Government/Public Sector

CTN :45512256

02 Jul, 2026 NA

Gwalior - Madhya Pradesh

Tender For supply of cell biological items c c - hacat cells , hff1 cells , dmem, high glucose pyruvate , 5 uaauuucuacuaaguguagau gauccguaaguccaugacgu 3 , 5 uaauuucuacuaaguguagau cuagguaccgacguagcauc 3 , 5 uaauuucuacuaaguguagau cgaugucagcuaagccgucg 3 , 5 uaauuucuacuaaguguagau ggaacguacgugagucguag 3 , 5 uaauuucuacuaaguguagau gcuagacugacgcgaugcug 3 , 5 uaauuucuacuaaguguagau guagcgugacgcgagcuagg 3 , 5 uaauuucuacuaaguguagau acgguccgauagcggacucg 3

State Government

CTN :45491316

18 Jun, 2026 8.00 Lacs

Sikar - Rajasthan

Tender For supply of lab items - c.b.c printer roll , edta k 3 vial 2 ml double cap , esr pipte disposable with citrate bulb , ecg jelly , j.s.b. stain 1 & 11 , 3.8 sodium citrate , cappilary tube , filter paper , hb meter , n/10 hcl,hb tube , blood group kit(igg + igm). , cover slips , glass slide , widal kit , vdrl card , hiv card , urine container , urine multi strip(9 strip) sd , urine strip(alb. sugar) , pragnancy card , deionized water(dw) , tissue paper , clinic spirit , cotton roll (500gm) , syringe (2 ml, 3 mi & 5 mi available) , niddle(24 no) lencet , supplies , soup bar , dropper , abx midili (20 ltr.) , abx cleaner (1 ltr.) , abx lyse (1 ltr.) , minicalir (1 ltr.) , c.b.c. control, positive, negative , hbs ag rapid test , glucose kit liquid , blood urea liquid , creatinine liquid , bilirubin liquid , sgot liquid , sgpt liquid , alk. phasptase liquid , total protien liquid , colestrol liquid , trigelsrides(tg) liquid , hdl liquid , vldl liquid , album kit , glucometer strip , plain tube without cap) , plain tube with cap , s. ldh , tips - yellow (1-50 mc itr.) , tips - blue (1 mi.) , plastic tube rack , micro pippte stand , dropping bottle , glass beaker , oil immersion , accu-check (glucometer cell) , total albumin , 10 micro liter fix , 5-50 micro liter (variable) , 10-100 micro liter (variable) , 100-1000 micro liter (variable)

Central Government/Public Sector

CTN :45178399

17 Jun, 2026 22.19 Lacs

East Khasi Hills - Meghalaya

Tender For corrigendum : supply of 70 percent ipa 5l jar 1st lot , 70 percent ipa 5l jar 2nd lot , egg albumin powder 100gm , 10 percent neutral buffer formalin , conical flask 1000ml , measuring cylinder 50ml , slides box 50 places , plastic container 500ml , lab plastic spatula 6 inch , lab plastic spatula 10 inch , aniline blue 25g , phosphomolybdic acid 25gm , ferric chloride 100gm , phosphotungstic acid 25gm , biebrich scarlet 25gm , pasteur pipette 1ml , pasteur pipette 10ml , lugols iodine 5 percent 500ml , silver nitrate acs 25gm , fuchsin basic 25gm , aluminium potassium sulphate dodecahydrate 500gm , hematoxylin stain powder 5g , ammonia solution 500ml , qualitative benedict solution 500ml , absolute alcohol 99.9percent acs grade or grades suitable for cytology and staining protocols 500ml 1st lot , absolute alcohol 99.9percent acs grade or grades suitable for cytology and staining protocols 500ml 2nd lot , absolute alcohol 99.9percent acs grade or grades suitable for cytology and staining protocols 500ml 3rd lot , paraffin wax pellets 500gm 1st lot , paraffin wax pellets 500gm 2nd lot , paraffin wax pellets 500gm 3rd lot , methanol acetone free lr grade 500ml 1st lot , methanol acetone free lr grade 500ml 2nd lot , chloroform 500ml 1st lot , chloroform 500ml 2nd lot , dpx 500gm , sodium phosphate di-basic anhydrous ar500gm , sodium phosphate mono basic 500gm , tween 20 500gm , filter paper packed of 100pcs , whatman filter paper packed of 100pcs , sodium chloride 500gm , sodium hypochloride 5l 5percent , improved neubauer chamber , wintrobes tube , sahlis heamometer complete set , microscope glass slide , micro cover glass 22x50 20 small boxes of 10g each per pkt , filter paper qualitative sheet , micro cover glass 22x60 20 small boxes of 10g each per pkt , hplc grade water 1l , d glucose anhydrous lr 500gm , sodium dihydrogen phosphate 500gm , potassium dihydrogen phosphate 500gm , 5,5 diphenylhydantoin 5gm , carbamazepine powder or crystals 5gm , methyl alcohol lr 500ml , test tubes 18x150mm , test tubes stand 3tier 18mm , methanol hplc grade 2500ml , potassium dihydrogen ortho phosphate ar monobasic 500gm , orthophosphoric acid , ether lr 500ml //bid details 2 / 55

State Government

CTN :45269509

25 Jun, 2026 NA

Gandhinagar - Gujarat

Tender For corrigendum : supply of laboratory reagents & items for gtps hospital. - multistix test strip, uristix 100 strip, malaria stix, hbsag cards diagnostic kits lab test, pregnancy card diagnostic kits lab test, hiv-aids card, methanol diagnostic kits lab test, cedardwood oil diagnostic kits lab test, anti a+b+d monoclonal aglutinating antisera, glucose stripe, widal slide diagnostic kits lab test, barium chloride 10 percentage diagnostic kits lab test, fouchets reagent, erba hdl 4x50ml, tissue paper roll, pippet tips yellow miscellenious items, pippet tips blue miscellenious items, esr pipete, typhoid ag/ab test, k3 edta tube, pvc centrifuge tube, sodium hypochloride 1 liter bottel, dengue antigen igm, washing solution diagnostic kits lab test, clot activator blood collection tube 4ml, cover slip, microscope lamp, h 560 diluent., h 560 lyse 1., h 560 lyse 2., h 560 elite h clean., auto wash, auto wash ac/al, multical, erba norm, glucose system pack, cholestrol system pack, triglyseride system pack, sgpt system pack, creatinine system pack, uric acid system pack, xl bilirubin -total, h 560 calibrator., pm kit

Central Government/Public Sector

CTN :45512021

02 Jul, 2026 9.50 Lacs

Kamrup - Assam

Tender For supply of n hexane , n hexadecane , dipotassium phosphate k 2 hpo 4 , potassium dihydrogen phosphate kh 2 po 4 , magnesium sulfate heptahydrate e- mgso 4 .7 h2o , toluene , xylene , brain heart infusion broth , lb broth , nutrient broth , soluble starch , iodine , skim milk sm agar , d- glucose , dpph 2 2 diphenyl-1-picrylhydrazyl , 2,4,6-tris 2-pyridyl-s- triazinetptz , ferric chloride anhydrous , acetate buffer , ferrous sulfate , triton x-100 octylphenol ethoxylate , dulbeccos modified eagle medium dmem , mrs broth , mrs agar , hydrogen peroxide , glycerol , sodium chloride , potassium chloride , calcium chloride , sodium bicarbonate , methanol , ethanol , peptone powder , yeast extract powder , l-cysteine hydrochloride , magnesium sulfate monohydrate mgso4 h2o , porcine t3 triiodothyronine elisa kit , porcine t4 thyroxine elisa kit , mda malon dialdehyde elisa kit , porcine sod1 superoxide dismutase cu-zn elisa kit , porcine cat catalase elisa kit , porcine igg immunoglobulin g elisa kit , porcine il-10 interleukin 10 elisa kit , porcine cortisol elisa kit , porcine tnf- tumor necrosis factor alpha elisa kit , porcine il-1 interleukin 1 alpha elisa kit , molecular grade ethanol , ethidium bromide , agarose powder , 10 x tae buffer , pcr master mix , nuclease free water , rna extraction kit , cdna synthesis kit , histopaque , chloroform , isopropanol , trizol , microcentrifuge tubes zero point five ml , microcentrifuge tubes 0.2 ml , pcr tube strips , microcentrifuge tubes 2 ml , microtube rack , pcr tube rack , pipette tips-10 microlitre , pipette tips-200 microlitre , pipette tips-1000microlitre , pipette holder , gloves , slide storage box , cryo box , cryo tags , petridish , glass wash bottle set 500 ml , burette 50 ml , volumetric flask 100 ml , sodium hydroxide pellets 5 kg , hydrochloric acid hcl 2.5 lit , sulphuric acid 2.5 lit , nitric acid 2.5 lit , perchloric acid 2.5 lit , petroleum ether 2.5 lit

Central Government/Public Sector

CTN :45516847

26 Jun, 2026 NA

Mysore - Karnataka

Tender For supply of fumigation liquid 2 per w v glutaraldehyde 5 per w v benzalkonium chloride solution ip corrosion inhibitors , inj pantaprazole , blood glucose strips for every thousand strips one glucometer , spinal needle 25g , gelatin sponge , surgical blade no 20 , povidine iodine solution 5 per , pop rolls 10cms , pop rolls 15cms , tab ranitidine 150mg

Central Government / Public Sector

CTN :44610237

13 Jun, 2026 7.95 Lacs

Kolkata - West Bengal

Tender For bid to ras supply of glucose reagent hexokinase 5x44 ml or 5 x 12.5ml erba , hiv tri dot 50 test rapid kit j mitra , urea reagent erba r1- 5 x 44 ml or r2- 5 x 11 ml , erbaqik hbs ag erba , erba mannheim biochemistry reagent kit creatinine enzymatic 5x30ml or 5x10 , erba mannheim urine test strip multistix 100 per kit , malaria rapid test kit j.mitra , erba mannheim biochemistry reagent kit , sgpt 6x44 or 6x12.5ml , erba mannheim biochemistry reagent kit , sgot 6x44 or 6x12.5ml , aso titre for 25test latex arkray , erba mannheim alkaline phosphatase small system pack 5 x 22 ml or 5x6.8ml , glass slide 50 per box , erba c r p xl crp- turbilatex with calibrator 2x22ml and 2x6.7ml , uric acid erba r1- 5 x 44 ml or r2- 5 x 11 ml , erba mannheim biochemistry reagent kit , total protein 10x44ml , erba mannheim biochemistry reagent kit , albumin 5x22ml , j.mitra dengue rapid test kit ns1 antigen 25 tests per kit , j.mitra h c v rapid test kit 50 tests per kit , urine,stool,container b positive urine culture bottle 30 ml 25 per pack , himedia technical grade buffer solutions, size 500 milliliter per bott. , disposable vaccum esr pipette pack of 100 , bd blood specimen collection tube vacum clot activator plain vial 100 per box , bd blood specimen collection tube vacum edta vial 100 per box , bd vacuum blood collection tubes sodium fluoride and edta 2 milliliter 100 per box , erba serum bilirubin direct kit system pack 6 x 44 ml or 6 x 12.3ml , erba serum total bilirubin kit system pack 6 x 44 ml or 6 x 12.3 ml , vaccutainer needle blood collection needle 22g 100 per box , erba mannheim serum triglyceride kit r1- 5 x 44 ml or r2- 5 x 11 ml , tarsons virgin polypropylene snap cap centrifuge tubes tarsons 500 per box , erba mannheim urine test strip material- plastic erba mannheimr glucose and ketone test strips 100 per kit , widal test kit slide test 4 antigen set s. typhi o,s. typhi h, s. paratyphi ah and s. paratyphi bh 5ml x 4 , cdh type a microscope immersion oil, size 50ml in plastic bottle 50ml bottle , pregnancy rapid test kit pak of 10 kit , glass straight funnel 1 x 1 , black marker pen 1 x 1 , erbaqik dengue ns1 antigen and igm plus igg antibody detection rapid test kit of 10 test , erbaqik syphilis antibody rapid test kit of 25 test , erbaa mannheim biochemistry reagent kit , ldl cholesterol 2x30ml or 2x10ml , erba mannheim biochemistry reagent kit hdl cholesterol 4x30ml or 4x10ml , coral cholesterol reagent 10x44ml , erba mannheim biochemistry reagent kit , rf 1x22ml or 1x5.5ml , ethanol absolute ar 1 ltr bott , tourniket , sodium hypochlorite solution 4 percent 1 ltr bott , siemens urine test strips combistix 100 strips per kit , haemospot for occult blood 50 test per kit or coral 50 per kit , cell pack 20 ltr. sysmex 20 ltr per pack , cell clean sysmex 50ml per kit , stromatolyser wh sysmex 500ml per kit , printing paper roll for sysmex xp 100 roll , ppd 5 tu 5ml arkray 5ml per kit , control sera for biochemical test for low bio-rad kit of 5ml x 12 , control sera for biochemical test for high bio-rad kit of 5 ml x 12 , eight check 3wp tri level control for haematology sysmex 2ml x3 per kit , lens cleaning tissue paper , erba xl wash kit 100ml x10 per kit , multical transasia 3ml x 4 per kit , seroquant r.a. control level 1 , seroquant crp control level 1 , vaccutainer needle holder , sulphuric acid 20 percent bott of 100 ml , test tube cleaning brush , conical centrifuge tube glass 15ml borosil , microtips 200 - 1000 microlitre box of 500 , erba auto wash ac or al 5x44ml //bid details 2 / 41

CTN :45332747

13 Jun, 2026 NA

Delhi - Delhi

Tender For bid to ras supply of biscuit glucose , chocolate , complan , cornflour 500 gms pkt , custard powder 500 gms pkt , custard powder 100 gms pkt , cornflour 100 gms pkt , dog biscuit , ground nut , protinex sugar free , sago , vinegar , orange squash , sausages

CTN :45512728

22 Jun, 2026 NA

East Sikkim - Sikkim

Tender For supply of eppendrof tube 0.5 ml plastic pkt of 100 , sample cup system pack for em 200 pkt of 500 , xl - multical system pack for em 200 4 3 ml , erba norm 1 x 5 ml , erba path 1 x 5 ml , glucose god pod system pack for em 200 10 x 44 ml , urea system pack for em 200 5 x 44 ml 5 x 11 ml , cholesterol system pack for em 200 10 44 ml , triglyceride system pack for em 200 5 x 44 ml 5 x 11 m , direct hdl system pack for em 200 4 x 30 ml 4 x 10 ml , uric acid system pack for em 200 5 x 44 ml 5 x 11 ml , total protein system pack for em 200 5 x 44 ml 5 x 11 ml , albumin system pack for em 200 10 x 44 ml , sgot el system pack for em 200 6 x 44 ml 6 x 12.5 ml , sgpt el system pack for em 200 6 x 44 ml 6 x 12.5 ml , alkaline phosphatase system pack for em 200 2 x 44 ml 2 x 11 ml , amylase system pack for em 200 5 x 22 ml , lipase xl system pack for em 200 1 x 44 ml 1 x 11 ml , ldh - p system pack for em 200 2 x 44 ml 2 x 11 ml , ggt system pack for em 200 2 x 44 ml 2 x 11 ml , calcium a system pack for em 200 5 x 6 ml , phosphorous system pack for em 200 5 x 6 ml , micro protein with cal system pack for em 200 5 x 6 ml , micro albumin control system pack for em 200 1 x 1 ml , micro albumin with cal system pack for em 200 1 x 5 ml 2 x 25 ml , contro h aso rf crp system pack for em 200 1 x 1 ml , control aso rf crp system pack for em 200 1 x 1 ml , xl crp with calibrator system pack for em 200 2 x 22 ml 1 x 11 ml , ec-90 pm kit , single blood collection bag 350ml , gram stain , sterile swab stick , chloroform ar analytical grade * /bid number : gem/2026/b/7577965 + /dated: 11-06-2026 ' ' / bid document 1 / 29

CTN :45512770

22 Jun, 2026 NA

East Sikkim - Sikkim

Tender For supply of eppendrof tube 0.5 ml plastic pkt of 100 , sample cup system pack for em 200 pkt of 500 , xl - multical system pack for em 200 4 x 3 ml , erba norm 1 x 5 ml , erba path 1 x 5 ml , glucose god - pod system pack for em 200 10 x 44 ml , urea system pack for em 200 5 x 44 ml oblique 5 x 11 ml , cholesterol system pack for em 200 10 x 44 ml , triglyceride system pack for em 200 5 x 44 ml oblique 5 x 11 m , direct hdl system pack for em 200 4 x 30 ml oblique 4 x 10 ml , uric acid system pack for em 200 5 x 44 ml oblique 5 x 11 ml , albumin system pack for em 200 10 x 44 ml , sgot - el system pack for em 200 6 x 44 ml oblique 6 x 12.5 ml , sgpt - el system pack for em 200 6 x 44 ml oblique 6 x 12.5 ml , alkaline phosphatase system pack for em 200 2 x 44 ml oblique 2 x 11 ml , amylase system pack for em 200 5 x 22 ml , lipase xl system pack for em 200 1 x 44 ml oblique 1 x 11 ml , ldh - p system pack for em 200 2 x 44 ml oblique 2 x 11 ml , ggt system pack for em 200 2 x 44 ml oblique 2 x 11 ml , calcium a system pack for em 200 5 x 6 ml , phosphorous system pack for em 200 5 x 6 ml , contro haso oblique rf oblique crp system pack for em 200 1 x 1 ml , contro laso oblique rf oblique crp system pack for em 200 1 x 1 ml , xl crp with calibrator system pack for em 200 2 x 22 ml oblique 1 x 11 m , pt reagent kit of 25 tests , diluent 20 ltrs for genrui automated hematology analyser , lh lyse 200 ml for genrui automated hematology analyser , diff lyse 500 ml for genrui automated hematology analyser , cbc -dh hematology control for genrui kt-6610 , cell pack 20ltr , stromatolyser , kit for estimation of cpk ck-nac 2x8 oblique 2x2 ml , strips albumin and glucose bottle of 100strips , rapid card screening for hcv , leishmans stain, rtu, bottle of 500 ml , reticulocyte stain, rtu, bottle of 500 ml , zn stain , hiv antibody 1 and 2 detection rapid test kit , occult blood test kit of 50 tests , semi auto hematology cell counterprintin paper roll , disposable esr tube , c reactive protein kit for 50 tests , widal kit , typhi dot test kit 30 test oblique kit , sterile petri dish medium 90 mm , urs- 10 urine reagent strips for urinalysis siemens , rapid card test for vdrl , strile urine container , leica 818 high profile microtome blades pkt of 50 blades , syringe 10 ml , syringe 5 ml , syringe 2 ml , sterile vacutainer , k3 edta vacutainer , sodium fluoride vacutainer , powder free gloves, latex, gamma irridation, size 6.5 , powder free gloves, latex, gamma irridation, size 7 , powder free gloves, latex, non sterile disposable gloves, , size 7 , micropipette, tips for 1-200 ul pack of 96 tips , micropipette, tips for 500-1000 ul pack of96 tips , chloroform ar analytical gade , gram stain , ra factor kit //bid details 2 / 51

Disinfection Mask Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector

State Government

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector