Latest dna extraction kit Tenders | Government dna extraction kit Tenders

CTN :39643331

17 Apr, 2025 NA

Shimla - Himachal Pradesh

Tender For corrigendum : procurement of machinery and equipment on behalf of directorate of health services hp - cardiac monitor, high pressure high speed horizontal steam instrument sterilizer, phacoemulsification unit, fess endoscopy unit, ent operating microscope, oae(clinical), ent workstations /treatment unit, shaver system cum micro drill, digital mammography unit, analogue mammography machine, computed radiography system for mammography, electro hydraulic operation table for orthopaedic surgery, surgical instrument set (ortho), autopsy(mortuary)table, mortuary cabinet (6- body), laparoscopic set with instruments, ctg machine, delivery table(obstetric labour table), foetal doppler, multipara monitor (obg), video colposcope, suction apparatus, autoclave horizontal, autoclave vertical, autoclave ot automatic, multi-channel electrocardiographic, fogging machine for ot (fumigator), crash cart trolley, infusion pump, retinoscope, indirect ophthalmoscope, electric cautery, laryngo-laryngoscope, digital otoscope, head light(ent), power drill for ortho, power saw for ortho, harmonic scalpel, laparotomy set, single puncture laparoscope for tubal ligation, spot light, note :-1.the basic price of the goods to be quoted without gst.2.all the prices should be quoted in indian rupee (inr) only.3.the cmc should be quoted year wise without gst.4.cmc rate and turnkey work (if any) shall be included for determining l-1 bidder.5.gst shall be payable as applicable from time to time.6.charges towards packing & forwarding, inland transportation, insurance (local transportation and storage) would be borne by the supplier from warehouse to the consignee site, loading/unloading and other local costs incidental to delivery of the goods to their final destination as per section-i shall also be borne by the supplier.7.the price should be inclusive of supply, installation, commissioning charges.8.l-1 will be determined item-wise on total basic price of the equipment (all inclusive) (excluding gst) + total cmc (if any) (excluding gst) + turnkey work (if any) (excluding gst) for all the items as mentioned in section-i.9.in case of optional accessories/items (if any), rates may quoted in separate pdf file (along with the price bid), which will not be considered for determining l-1 bidder. it is reiterated that the bidder should not submit this in the technical bid.it is certified that the cost of goods shown above, is all inclusive except gst.signature of authorizedsignatory with seal

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39235989

01 Apr, 2025 NA

Guntur - Andhra Pradesh

Tender For corrigendum : procurement and supply of equipment to teaching hospitals for upgradation of pg seats in a.p with a period of 2 years rate contract-, 800ma digital fluoroscopy unit, , computerized radiography (cr) with single cassettes, , computerized radiography (cr) with multi cassettes, , digital mammography system with tomosynthesis, , cr cassettes, , icu ventilator, , neonatal ventilator, , pacemaker (temporary) - single chamber, , holter monitor, , treadmill test system, , heart lung machine with tcm, , sternal saw handpiece, , anesthesia workstation, , fibre optic laryngoscope, , peripheral nerve stimulator, , pre sterile scope sets for bronchoscope, , biopsy punches, , hyfractor/electro surgical instruments, , iontophoresis, , nbu chamber, , puva chamber total body, , woods lamp, , operating microscope for plastic surgery, , instrument set for orthognathic/maxillofacial surgery, , instrument set for rhinoplasty, , instrument set for micro surgery, , skin grafting mesher, , co2 laser, , visual field analyser, , non-contact tonometer, , streak retinoscope, , ophthalmic operating microscope with teaching aid, , trial frame and refraction lens sets, , auto lensometer, , direct ophthalmoscope, , slit lamp with teaching aid:, , nd-yag laser:, , analgesimeter, , mosso's ergograph, , perimeter(priestly smith), , pt and aptt automated analyzer, , gel electrophoresis unit, , paper chromatography chamber, , water bath, , hysteroscope, , cryo cautery, , binocular microscope with camera, , digital water bath, , laminar flow vertical, , equipment for psychological evaluation, , kidney transplant instruments, , capd equipments, , vascular access instruments, , kidney biopsy instruments, , ,

Central Government/Public Sector

CTN :37767555

04 Apr, 2025 NA

Raigad - Maharashtra

Tender For corrigendum : supply of full field digital mammography system

CTN :39622588

29 Mar, 2025 NA

Pune - Maharashtra

Tender For supply of hiv rna real time quantitative pcr kit 96 test kit , chikungunya real time pcr kit ivd ce usfda approved , barrier filter tips 20 ul sterile racked , barrier filter tips 200 ul sterile racked , sterile microtips with barrier filter dnase, rnase protease free molecular grade in closed box of 96 tips 0.5 ul - 10 ul , dna extraction kit from blood serum plasma ce ivd approved

Central Government/Public Sector

CTN :39622985

28 Mar, 2025 NA

Bangalore - Karnataka

Tender For purchase of chemicals and consumables - agar pt pure , agar agar type i , sodium alginate , antimicrobial supplement , cephotaxime sodium salt , calcium nitrate , d-glucose anhydrous , hygromycin-b , lcystein , metatopolin , phytawrap , sucrose , syringe driven filters , phyta jar , streptomycin sulphate , supplement for ms media , dichloromethane , diethylether , toluene , cyclohexane , p-anisaldehyde , acetone , qualitative filter paper , formaldehyde , acetone pure , n hexane pure 99 percent , n pentane extra pure 99 percent , tlc aluminium sheets silica gel 60f 254 , storage vial 10 ml , funnel plastic , ethanol , toluene ar grade , octanoic acid or caprylic acid , ethanolamine , agar agar type i , malt extract powder , methanol , toluene lr grade approx. 98 to 99 percentage purity , ethyl acetate, hi-ar , weasons salt mixture , yeast tablet , methyl para hydroxy benzoate , sorbic acid , cellulose , ascorbic acid , choline chloride , potassium hydroxide pellets , agar agar type 1 , sodium hypochlorite ar acs 4 percentage wight by volume solution , potato dextrose agar, granulated , nutrient agar , nutrient broth , potato dextrose broth, granulated , sabouraud chloramphenicol agar , gibberellic acid , formaldehyde solution 37 to 41 percent, hi lr , potassium permanganate hi ar , chloramphenicol,for molecular biology , gram stains - kit , beaker , conical flask , glass spreader , inoculation loop , forceps , cork borer , spatula , jerri can , micro slides , microscopic cover slips , measuring cylinder transparent , immersion oil , apparatus , insect breeding dishes , dna extraction kit , dna purification kit