Dna Extraction Kit Tenders

Get complete information related to latest Dna Extraction Kit Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Dna Extraction Kit Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Dna Extraction Kit Tenders .

Filter

Loading....

Get Tender in Email

Central Government/Public Sector

CTN :40033396

08 May, 2025 NA

Bhopal - Madhya Pradesh

Tender For procurement of various consumables for routine diagnostics items for the dept of microbiology - rare disease medicine, ana igg profile (ena) (16x1), ana kit, anca kit, anti cardiolipin iga, anti cardiolipin igg, anti cardiolipin igm, anti ccp 2 elisa igg (euoroimmun), anti ds dna- ncx elisa igg (euoroimmun), anti mpo pr3/gbm (euoroimmun), anti gbm 96test, anti mpo 96test, aspergenius 2.0 species (lot-lpn2023057), aspergiillus species multiplex 28s rrna gene target kit, aspergillus ict igg igm (aspergillus fumigatus igm 96test), beta-d-glucan assay kit for dignosis of invasive fungal fungitel (25 tests per kit), brucella igm elisa kit (96 tests), chikungunia igm elisa kit (96 tests), cmv viral load quantitative real time pcr make altona (96tests), colum based viral rna extraction kit (qi aamp viral rna mini kit cat no. 52906, make: qiagen) (250tests), columbia agar + 5% sheep blood plates or trypticase soy agar + 5% sheep blood plates (50plates), crypto ps antigen (biosynx) 20tests, dengue igm elisa kit (96 tests), dna extraction kit, echinococcus igg antibody elisa kit (96tests), elisa for cmv igg kit, make drg international ivd, entamoeba histolytica igg elisa (96tests), fecal occult blood test ict kit (cancheck fobt) (10 tests), filariasis antigen detection immunochromatography kit, galactomannan aspergillus ag (96tests), genexpert c. difficile pcr assay kit (96 test per kit), hepatitis b hbsag elisa kit (96tests), hepatitis b viral load assay, rtpcr kit (96tests), hepatitis c total antibody elisa kit (96tests), hepatitis c viral load assay, rtpcr kit (96tests), histoplasma (oidx be sure) histoplasma capsulatum (20tests), igm antibody detection by elisa scrub typhus / scrub typhus igm elisa kit (96tests), leptospira antibody detection igm elisa kit (96tests), mini parasep sf faecal consentration tube (40tests), oxid be sure kit (200assayes), pneumocystis jirovecii qpcr kit 25rxn, quantitative real time for bk virus ivd kit (96tests), quantitative real time for epstine bar virus ivd kit ebv (96tests), quantitative real time for jc virus (96tests), rpr kit (250tests), sterile filtered ab serum, toxin a+b toxin detection c. difficiel kit vitassay (7715024) (10tests), toxoplasma gondi igg elisa kit (96tests), toxoplasma gondi igm elisa kit (96tests), toxoplasma igg avidity antibody elisa kit (96tests), widal slide test kit (250tests), widal tube test kit (4x50ml), cl.difficile toxin a&b rapid card test (10t), tab. everolimus 2.5mg, tab. everolimus 5mg, tab. everolimus 7.5mg, tab. everolimus 10mg, inj. ravulizumab 300mg/3ml, inj. ravulizumab 1100mg/11ml, inj. alirocumab 75mg/ml, inj. alirocumab 150mg/ml, inj. evolocumab 140mg/ml, inj. inclisiran 284mg/1.5ml, inj. burosumab 10mg/ml, inj. burosumab 20mg/ml, inj. burosumab 30mg/ml, inj. vutrisiran 25mg/0.5ml, inj. givosiran 189mg/ml, tab. voxelotor 500mg, tab. olaparib 150mg, tab. tucatinib 150mg, tab. ponatinib 15mg, tab. ibrutinib 140mg, inj. ustekinumab 130mg, inj. ustekinumab 90mg, inj. eculizumab 300mg, inj. brentuximab 50mg, isoleucine, leucine and valine free diet powder, lysine and tryptophan free diet powder, methionine free diet powder, leucine free diet powder, isoleucine, methionine, threonine and valine free diet powder, protein and amino acid free diet powder (with and without fat), phenylalanine free diet powder, non-essential amino acid free diet powder, phenylalanine and tyrosine free diet powder, galactose free formula, milk protein-based powder with medium-chain triglycerides (mct) for children and adults, protein hydrolysate formula base powder with iron for use with added carbohydrate, protein free formula, low carbohydrate, sucrose, fructose, sugar free formula, low protein substitutes glucose polymers individual amino acids, low protein. low fat & high carbohydrate formula, uncooked cornstarch with vitamins and minerals, human hemin for inj. 350mg hemin per vial, tab. carglumic acid 200mg, inj. hydroxocobalamin 30mg/ml, inj. lumasiran 94.5mg/0.5ml, inj

CTN :39926419

26 Apr, 2025 NA

Kolkata - West Bengal

Tender For supply of rapid immunochromatography kit for typhoid fever , hbsag detection kit immunochromatography , hcv detection kit immunochromatography , hiv detection kit immunochromatography , ns1 antigen for dengue detection , dengue duo ns1 plus ab combo , hbsag elisa kit kit of 96 wells , ana elisa kit of 96 wells , rapid agglutination test for salmonella widal 4x5 ml , rapid latex agglutination ra factor test with controls , rapid latex agglutination crp test with controls , rapid latex agglutination aso test with controls , hiv elisa kit kit of 96 wells , hcv elisa kit kit of 96 wells , rapid pregnancy detection by immunochromatography , anti ccp elisa kit of 96 wells , micro tips 5 to 200 ul , filtered tips 0 point 2 to 10 microliter box of 96 , nitrile powder free hand gloves non sterile size 7 point 5 , nuclease free water for pcr , 10 x tbe buffer , dna ladder 100 bp , dna extraction kit from blood by spin column base , hla b27 kit of 96 tests , deionized water , vacutainer heparin 9 ml , phosphate buffered saline , agarose powder molecular biology grade , 15 ml falcon tube , 50 ml falcon tube , dengue igm elisa kit of 96 tests , sterile container for urine collection , dextrose monohydrate for oral use in pack of 100 gm with or without vitamins and minerals , uristix glucose plus albumin , urine multistix cards min 10 parametres compatible to siemens urine analyser , kit for stool occult blood 50 tests

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Loading, Please wait...

Dna Extraction Kit Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector