Latest duralyst Tenders | Government duralyst Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39792980

14 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For price agreement of medicines drugs lab items and surgical items for a period of one year - procurement, diethyl ether solvent bott of 500 ml, lignocaine hcl 2 percent (without adrenaline) 30ml inj (suitable for ophthalmic use also), lignocaine hcl 2 perecent with adrenaline (1:80000) 30ml inj, diclofenac 75 mg/ml, 1 ml amp inj, lignocaine 100mg& ethanol 28mg/ml v/v spray container of 500/800ml, lignocaine hcl jelly 2percent tube of 30 gm with sterile tube and short nozzle suitable for intra uretheral use, should be packed within a sterile blister pack, atropine sulphate 0.6mg, 1 ml inj, midazolam 5 mg, 1 ml inj, paracetamol 650 mg tab, aceclofenac 100 mg, paracetamol 500 mg tab, paracetamol 325 mg + diclofenac sodium 50 mg tab, diclofenac sodium sr 100 mg tab, paracetamol with cysteine hcl monohydrate infusion 1000 mg/100 ml, common cold tab (cetirizine 5-10 mg + paracetamol 500 mg + pseudoephedrine 30-60 mg), deflazacort 6 mg, tab, diclofenac sodium 50 mg, enteric coated tab, diclofenac 25mg/ml ip, 3ml inj, ibuprofen 200 mg tab, ibuprofen syrup 100mg/5ml bott of 50 ml, ibuprofen 400mg tab, paracetamol 10 mg/ml infusion in 100 ml bottle, diclofenac diethylamine 2.32% w/v, quick penetrating topical solution-30 ml bottle, with metered dose spray, naproxen 250mg tab, paracetamol 500mg tab, paracetamol 150mg/ml, 2 ml iv, inj, paracetamol syp 125mg/5ml bott of 60 ml, paracetamol 325mg and ibuprofen 400mg tab, etoricoxib 120 mg tab, piroxicam 20 mg tab, piroxicam 40mg, 2ml inj, morphine 15mg, 1 ml inj, indomethacin 75 mg sr tab, allopurinol 100 mg tab, indomethacin 25mg tab/cap, ketorolac10mg tab, tramadol hcl 50 mg cap/tab, tramadol hc 50 mg/ml inj, aceclofenac 100 mg tab, febuxostat 40 mg tab, adrenaline tartrate (1:1000), 1 ml inj, cetrizine-dihydrochloride 10 mg tab, levo-cetrizine 5mg tab, cyproheptadine 4 mg tab, fexofenadine 30mg/5ml in 60ml bottle, montelukast 10mg + levocetrizine 5mg tab, promethazine syp 5mg/5ml bott of 60 ml, dexamethasone 0.5 mg tab, dexamethasone sodium phosphate 4.4 mg (equivalent to dexamethasone phosphate 4 inj, pregabalin 75 mg + methylcobalamine 1500 mcg tab, hydrocortisone sodium succininate 100 mg inj, pheniramine maleate inj 22.75 mg per ml amp of 2 ml, nor adrenaline bitartrate 2 mg/ml, 2 ml inj, pheniramine maleate 25 mg tab, prednisolone 5 mg tab, promethazine hcl 2.5percent, 25mgm/ml, 2 ml inj, pralidoxime 500mg/20ml inj, n-acetyl cysteine 200 mg/ml, 5 ml ampoule, divalproate sodium 500 mg, tab, pregabaline 75mg cap, levetiracetam 500 mg tab, oxcarbazepine 150 mg tab, oxcarbazepine 300 mg tab, carbamazepine 200 mg tab, carbamazepine 200 mg cr tab, carbamazepine syp 100mg/5ml bottle of 100 ml, clobazam 5 mg tab, clonazepam 2 mg tab, lorazepam 2mg/ml, 2ml inj, diazepam 10 mg, 2 ml inj, donepezil 5 mg tab, diazepam syp 2 mg/5 ml bottle of 60 ml, diazepam 5 mg tab, gabapentin 300 mg cap, phenytoin oral suspension containing phenytoin 100mg/4ml bottle of 100 ml, phenytoin sodium 100 mg tab, sodium valproate oral solution 200mg/5ml bott of 100 ml, sodium valproate 200 mg tab, lamotrigine 25 mg tab, sumatriptan 50 mg tab, sumatriptan nasal spray 20 mg, 10 metered doses, topiramate 25 mg tab, rizatriptan 5 mg tab, baclofen 10 mg tab, budesonide 200mcg inhaler, budesonide 200 mcg + formeterol 6 mcg autohaler, budesunide 1 mg respules, canagliflozin 100 mg tab, carbimazole 20 mg tab, chlorzoxazone 500 mg + diclofenac sodium 50 mg + paracetamol 325 mg tab, salmeterol 25 mcg + fluticasone 250 mcg autohaler, diacerin 50 mg tab, doxophyllin 400 mg tab, mesalazine 500mg tab, albendazole 400 mg tab, albendazole syp each 5 ml containing 200 mg bott of 10 ml syp, sitagliptin 50 mg + metformin 500 mg tab, ivermectin 6mg tab, amoxycillin ip 500 mg cap, spacer device for inhaler, pyrantel pamoate 250 mg/5ml susp., diethylcarbamazine 50mg tab, amitriptylline 25 mg tab, itopride 50mg tab, rifampicin 450mg + isoniazed 300mg combination cap/tab, rifampicin 600 mg+tab inh 300mg tab, ethambutol 200 mg tab, isoniaz

Central Government/Public Sector

CTN :39446096

28 Mar, 2025 NA

Belgaum - Karnataka

Tender For corrigendum : supply of commercial ether - 1 diethyl ether commercial per liter , 2 diethyl ether commercial per liter , 3 diethyl ether commercial per liter , 4 diethyl ether commercial per liter , 5 diethyl ether commercial per liter

Central Government And Public Sector

CTN :39478737

27 Mar, 2025 14.49 Lacs

Belgaum - Karnataka

Tender For corrigendum : supply of chemicals and consumables amr rkj - n-hexane 2.5 ltr , hexane-ar 2.5 ltr , ethyl acetate er 2.5ltr , dichloromethane 2.5 ltr , diethyl ether er 500 ml , methanol er 2.5 ltr , methanol hplc gradient grade 2.5 ltr , tetrahydrofuran hplc 1 ltr , silica gel 230-400 mesh 500 gm , silica gel 60-120 mesh 500 gm , sephadex g-10 50 gm , orientin , vitexin , isovitexin , homoorienti , isoorientin , apigenin , oleic acid , linoleic acid , methyl palmitate , palmitic acid , luteolin , myricetin , ergosterol , enlarging connecting adaptor , condensers , funnel 75 mm , funnel 100 mm , funnel 250 ml , condenser 3741016 , condenser 3741020 , rod for retort base burette stand , clamps , bossheads , spatula 6 inch , spatula 8 inch , glass mortar and pestle 150 x 110 , glass mortar and pestle 80 x 60 , boropure celulose nitrate membrane , boropure nylon 66 membrane hplc grade , pasteur pipette, ldp 3 ml , handypette pipette aid 10 ml , parafilm , chloroform-d , methanol-d4 , dimethyl sulfoxide-d6

CTN :39567888

26 Mar, 2025 NA

Sagar - Madhya Pradesh

Tender For supply of items and equipment for botany, zoology,physics, chemistry and geography laboratory - name of equipment -geography lab, plain table set, prismatic compass, weather maps set, chain tape set, compass 100mm, levelling staff 4meter, illuminating, globe 3 dimensional physical, illuminating, globe 3 dimensional political, photo of great geographers, relief maps of india, topo sheets ( survey of india), set of 25 non-metallic minerals for industrial use, ranging rod, almirah (full size), name of equipment -zoology lab, digital single pan balance 300gm, digital ph meter, digital thermometer, haemocytometer(complete box), sphygmomanometer, compound microscope, water distillation apparatus 4lit. s.s., electrophoresis submarine with power supply, centrifuge machine doctor model 8tubes, haemoglobinometer, spectrophotometer, almerah, slides, coverslip, cavity slide, test-tube, beaker ( 50 ml ,100 ml,250 ml ), watch glass 3 , conical flask (100 ml , 250 ml), tissue paper, filter paper, models, specimens, permanent slides, (d human skleton model, name of equipment -chemistry lab, beaker ( 50 ml , 100 ml , 250 ml), burette 50ml, conical flask ( 50 ml , 100 ml , 250 ml, pipette ( 10 ml , 25 ml ), volumetric flask (100ml , 250 ml , 500 ml ), watch glass 3 , spatula, glass rod, measuring cylinder (50 ml , 100 ml ), funnel 75mm, test-tubes, tripod stand, burette stand, glass slides pkt, bunsen burner, desiccator, ignition tube, glass bottles 250ml, sprayer, filter paper, whatmann filter paper no.1, chromatographic jar, tlc kit, corks, test-tube stands, vaccum pump, distillation unit s.s. 4lit., reflux unit, round bottom flak 250ml, digital chemical balance, thermometer, colorimeter, ph-meter, theles-tube, water bath /sand bath, almirah, sodium chloride 500gm, anti a, b,d (3x10ml), methanol 500ml, acetocarmin 100ml, xylol (xylene) 500ml, canada balsam 100ml, eosin 125ml, glycerine 500ml, potassium hydroxide 500gm, sodium hydroxide 500gm, chloroform ( 500 ml ), d p x mountant 250ml, distill water 5lit., acetone 500ml, acetic acid 500ml, ammonium chloride 500gm, sodium sulphate 500gm, acetanillide (500gm), ammonium acetate 500gm, ammonium ferrous sulphate (500gm), ammonium carbonate(500gm), benzoic acid 500gm, copper sulphate (500gm), conc. hydrochloric acid 500ml, conc. sulphuric acid 500ml, calcium chloride (500gm), chloroform ( 500 ml ), ethyl alcohol ( 500 ml ), ethyl acetate ( 500 ml ), ferric chloride (500gm), fehling solution a 500ml, fehling solution b 500ml, glacial acetic acid ( 500 ml ), glycerine ( 500 ml ), ferrous sulphate (500gm), iodine (100gm ), nepthalene (500gm), nitric acid ( 500 ml ), alpha naphthol (100gm), beta nephthol (250gm), oxalic acid (500gm), phenyl hydrazine 250ml, potassium dichromate (500gm), potassium permanganate(500gm), phenophthalein 125ml, phthalic acid 500gm, phenol 500gm, resorcinol 250gm, sodium metal 100gm, sodium carbonate (500gm), sodium nitrite (500gm), salicylic acid (500gm), starch 500gm, sucrose (500gm), silica gel g for tlc 500gm, zinc dust 500gm, buffer tablets ( 4,9,7 ) 10tab. each pack, benedict solution 500ml, molisch reagent 125ml, silver chloride 25gm, lead acetate (500gm), methylene blue 125ml, nesslers reagent 100ml, methyl orange 125ml, urea crystal (500gm), calcium carbonate (500gm), edta solution 500ml, pot. chloride (500gm), diethyl ether (500 ml ), dimethyl glyoxime (100gm), ammonium hydroxide (500ml), ferric sulphate (500gm), magnesium chloride (500gm), zinc chloride (500gm), silver nitrate (25gm), barium chloride (500gm), manganese sulphate (500gm), aluminum sulphate (500gm), pot. nitrate (500gm), sodium acetate (500gm), aluminium foil, formaline 500ml, acetone( 500 ml ), safranine sol. 125ml, haematoxylin 125ml, crystal violet-used to stain bacteria 125ml, name of equipment -botony lab, petri dish 3 , watch glass 3 , wash bottles plastic 500 ml, wash bottles plastic 250ml, cover silp 22mm blue star, plain slides, flasks ( 100 ml , 50 ml , 200 ml ), beaker ( 50 ml ,100 ml,200

CTN :39630835

31 Mar, 2025 NA

Uttara Kannada - Karnataka

Tender For supply of diethyl ether solvent bott of 500 ml , inj etomidate 2 mg per ml, 10 ml vial , lidocaine or lignocaine hcl 2 percentage with adrenaline or epinephrine, latex and methyl paraben free glass cartridge of 1.8 ml , lignocaine hcl jelly 2 percentage tube of 30 gm with sterile tube and short nozzle suitable for intra urethral use, should be packed within a sterile blister pack , peracetic acid bott of 810 gm , common cold tab, cetirizine 5 to 10 mg, paracetamol 500 mg, pseudoephedrine 30 to 60 mg , deflazacort 6 mg, tab

CTN :39562287

25 Mar, 2025 19.85 Lacs

Leh - Jammu And Kashmir

Tender For supply of diethyl ether solvent bott of 500 ml , isoflurane bottle of 100 ml , thiopentone inj of 0 point 5 g without water for inj , sevoflurane bottle of 250 ml closed fill system with integrated non removable adapter , ing epinephrine 1 by 10 000 , lignocaine hci 2 percent without adrenaline 30 ml inj , paracetamol with cysteine hcl monohydrate infusion 1000 mg per 100 ml , atropine sulphate 0 point 6 mg 1 ml inj , pot momopersulphate 1 percent potassium peroxymonosulfate is same item , isoproponol 60 percent and benzalkonium chloride skin disinfectant 60 gm per 0 point 025 gm and 100 gm , 1 6 dihydroxy 2 to 5 dioxahexane gluteraldeyde benzylalkonium chl alkyl urea derivative 11 point 2 gm per 5 point 0 5 gm per 3 gm in 100 gm , lignocaine 100mg plus ethanol 20 mg per ml spray , diclofenac sodium sr 100 mg tab , pyroxicam 20 mg tab , dexamethasone 0 point 5 mg tab , methylprednisolone 16 mg tab , promethazine hcl 2 point 5 percent 25 mgm per ml 2 ml inj , phenobarbitone sod 200mg 1 ml inj , inj fosphenytoin 75 mg per ml 02 ml ampoule

CTN :39562310

25 Mar, 2025 13.00 Lacs

Leh - Jammu And Kashmir

Tender For supply of diethyl ether solvent bott of 500 ml , inj diclofenac 75mg per ml 1 ml amp , lignocaine 100mg plus ethanol 20 mg per ml , alcohol based antimicrobial bgand gel containing ethyl alcohol 60 to 70 percent propanol 60 to 70 percent with emollient humectant moisturiseer and macetronium ethylsulphate 0 , paracetamol with cysteine hcl monohydrate infusion 1000 mg per ml , paracetamol 10 mg per ml infusion in 50 ml bottle , diclofenac diethylamine 2 point 32 percent w by v quick penetrating topical solution 30 ml bottle with metered dose spray , naproxen 250 mg tab , paracetamol 150 mg per ml 2 ml iv inj , morphine 15 mg 1ml inj , montelukast 10 mg plus levocetrizine 5 mg tab , pregabalin 75mg plus methylcobalamine 1500 mcg tab , hydrocortisone sodium succininate 100 mg inj , pregabaline 75 mg cap or tab , levetiracetam 100 mg per ml syp or soln or liquid , lorazepam 2 mg per ml 2 ml inj , salmeterol 25 mcg plus fluticasone 250 mcg autohaler , insulin analogue long acting basal plus long acting glp 1 analogue in pfs or pfp inj , spacer device for inhaler , clotrimazole mouth paint 1 percent bottle of 15 ml , ondansetron 2mg per ml 4 ml inj , tab methylcobalamine 1500 mcg , gel choline salicylate and benzalkolium chloride gel of 10 ml , inj tenecteplase 20 mg , amiodarone hci 150 mg 3 ml inj

Duralyst Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government And Public Sector