Latest ent drill system Tenders | Government ent drill system Tenders

CTN :39873932

08 Apr, 2025 NA

Chandigarh - Chandigarh

Tender For supply of cbnaat mtb/rif ultra pcr test kit (q3) ( pac only )

Central Government And Public Sector

CTN :38680740

31 Mar, 2025 NA

Pondicherry - Pondicherry

Tender For bid to ras supply of consumables - qubit tm 1x ds dna hs assay kit ,100 assay , qubit tm assay tubes, set of 500 , qubit tm rna hs assay kit, 100 assay , qubit tm rna br assay kit ,100 assay , ampure xp reagent,5 ml , water, sterile, molecular biology grade depc treated, nuclease and protease free ,100ml , premium grade ethanol 100 percentage,500 ml , q5 pcr master mix 2x high fidelity new england biolabs,500 reactions , promega gel loading dye 6x , 100bp ladder dx per dt loaded with green dye ,500 ul,50 ug , invitrogen ladder 1kb plus dna ladder, 1 ml 10x loading buffer ,500 ul , hi-syrr safe gel stain ,10,000x in dmso , agarose ,500 g , tae 50x ,1l , preperation rack, 96 well, with cover , 50 well microtube storage box, for 1.5 to 2.0 ml tubes , dneasy blood and tissue kit ,250 rxn , kimberly clark kimwipes, 14.7 in 16.6 in, 140 count , m 4 inch parafilm tape, color white , autoclave indicator tape , ethanol, absolute ,200 proof, molecular biology grade, fisher bioreagents , rsa i restriction enzyme ,neb , neb blunt per ta ligase master mix,250 rxn , neb next ffpe repair mix,96 rxn , neb next ultra ii end repair or da-tailing module,96 rxnx , neb next quick ligation module , 12 tube magnetic seperation rack , flow cell priming kit , native barcoding kit ,24 barcodes , flowcell wash kit , flongle flow cell ,pk 1 , luria bertami agar, miller luria bertani agar , luria bertani broth, miller , l spreader , sterile disposable petriplates , ampicillin sodium salt ,amp,na,5g , kanamycin monosulphate ,km, extrapure, 750mcg per mg,5g , his,tagged bacterial protein ,gravity flow , carbenicillin disodium salt, 90 percentage ,5g , isopropyl b d thiogalactopyransoside ,iptg, dioxan free for mb, 99 percent 25 g bid number/ ( ( ) ) : gem/2024/b/5741465 dated/ * : 23-12-2024 bid document/ 2 2 1 / 36

corporations/Associations/Others

CTN :39847369

07 Apr, 2025 NA

Parganas - West Bengal

Tender For supply of cbnaat mtb/rif ultra pcr test kit (q3) ( pac only )

State Government

CTN :39841859

17 Apr, 2025 NA

Varanasi - Uttar Pradesh

Tender For supply of reagents and consumables for sanger sequencer model abi 3500xl - bigdye terminator v3.1 sequencing kit, 100 reaction, bigdye xterminator purification kit.100 preps, bigdye terminator v1.1,v3.15x sequencing buffer ,1ml, high capacity cdna reverse transcripastion kit with rnase inhibitor ,1000rxn, genescane 500 liz standrad 800 rxn, exosap-it clean up kit, 100 rxn, hidi formamide,5mlx4 pack, cathode buffer container, anode buffer container, multicapilliary ds33,8 runs, pop7,960 rxn, conditioning reagents, platinum superfi pcr master mix ,100 reaction, clonejet pcr kit, ro rxn, competent cells 10x100 ul, fix 7 perm medium a,100 ml, fix 7 perm medium b,100 ml, fluorescent primers,10000p moles, pop7,96 rxn, generuler dna ladder lo0bp s0ug fermantas, 6xloading dye solution r0611 mbi fermenta, microamp clear adhesive film, 100 pc, septa 96 well plate, microamp optical 96 wells reaction plate barcoded, superscript vilo cdna synthesis kit

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39732654

07 Apr, 2025 NA

Ahmedabad - Gujarat

Tender For corrigendum : supply of cbnaat mtb / rif pcr test kit (q3) ( pac only )

Central Government And Public Sector

CTN :39835167

16 Apr, 2025 NA

Chennai - Tamil Nadu

Tender For supply of lab item - qiaamp viral rna mini kit , nuclease free water , kapa hifi hotstart ready mix , qiaquick gel extraction kit , gotaq long pcr master mix , bigdye terminator sequencing buffer , exosap it pcr product cleanup , bigdye terminator sequencing kit , pop 7 polymer , hi di formamide

CTN :39836330

16 Apr, 2025 7.00 Lacs

Bahraich - Uttar Pradesh

Tender For supply of naat based pcr test kit (q2) ( pac only )

CTN :39836024

05 Apr, 2025 56.0 Thousand

Rajauri - Jammu And Kashmir

Tender For supply of naat based pcr test kit (q2)

CTN :39578360

02 Apr, 2025 NA

Shahdol - Madhya Pradesh

Tender For corrigendum : supply of zoology lab equipment - procurement of zoology lab equipment, automatic microtome, tissue embedding moulds, multimedia projector (dlp), basic molecular biology teaching kits, dna fingerprinting teaching kits, dna extraction teaching kit., rna extraction & rtpcr teaching kits, blotting teaching kits, chromatography teaching kits, electrophoresis teaching kits, immunology teaching kits, bacterial genetics & sensitivity teaching kit (microbiology), meiosis lab-work shop kit, mitosis lab-work shop kit, electrophoresis apparatus, digital haemoglobinometer (hbmeter), haemocytometer with counting chamber, rbc/wbc pipettes with latex tubing, stethoscope standard with all accessories, micro pipette (college grade) variable volume any range, microlit electronic micropipette, eectronic waterandsoil analysis kits, soil testing equipment, soil and water testing and under water study equipments, soil and water testing and under water study equipments, electronic pocket testersimported, electrical apparatus, entomological equipment, insect trapsand insect cabinets, craft s entomology pins, insect killing bottle insecticides and insect cages, collection equipments (insect, planktons), general laboratory accessories, stainless steel laboratry tray with cover (surgical), blue seal concavity slides(per packet of 12 slides), dissection boxes (best quality) with stainless steel, skeletons (articulated on base) -human body,fowl in showcase,labeo fish, wallago or any bony fish, pcr, binocular research inclined microscope with imported binocular head, tromascope projection micro-scope (dual purpose), areater (dubble pump) delux quality heavy duty, water filter extra powerful, aquarium net rectangular with handle, aquarium heater submergiable 100 watts, dissection boxes (best quality) with stainless steel, water testing kit model b , gel electrophoresis apparatus, digital haemoglobinometer (hbmeter), automatic hematology analyzer, electronic water & soil testing analysis equipment, research centrifuge machine

Ent Drill System Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector

corporations/Associations/Others

State Government

Central Government/Public Sector

State Government

Central Government And Public Sector