Latest erbium oxide Tenders | Government erbium oxide Tenders

State Government

CTN :39856264

15 Apr, 2025 184

Mangalore - Karnataka

Tender For tenders are invited from the manufacturers/ dealers for the supply of chemicals/glassware/ consumables of reputed brands required for applied zoology department for a period of one year. - wash bottle- az, coplin jar- az, handypette - az, pipette bulb- az, dropping bottle 1- az, dropping bottle 2- az, measuring beaker with handle 1- az, measuring beaker with handle 2- az, measuring beaker with handle 3 - az, beakers 4-az, beakers 5-az, beakers 6-az, beakers 7-az, beakers 8- az, test tubes- az, watch glass 2- az, embryo cup- az, pasture pipette - az, pipette pump 3- az, beaker 11- az, beaker 22- az, beaker 03- az, beaker 04- az, beaker 05 - az, test tube rack - az, hand gloves - az, insect catching net - az, test tube washing brush 1- az, buratte stand- az, lancet- az, micro spin magnetic stirring bar 2 - az, alluminium foil - az, tissue paper roll- az, blotting paper 01- az, benidicts reagent qualitative-az, benidicts reagent quantitative-az, biurate reagent-az, blotting paper-az, borax-az, measuring cylinder 11-az, measuring cylinder 22-az, measuring cylinder 33-az, measuring cylinder 44-az, measuring cylinder 55-az, measuring cylinder 66-az, measuring cylinder 77-az, conical flask 11-az, conical flask 22-az, conical flask 33-az, watch glass 22-az, glass droppers 2-az, morter and pestile-az, micro slides 1-az, micro slides 2-az, spirit lamp-az, test tube holder-az, beakers 11-az, beakers 2-az, beakers 3-az, dmso.dimethylsulfoxide.-az, dna isolation kit-az, dpx moutant-az, drosofila culture bottel -az, ethanol molecular biological grade-az, ethidium bromide -az, fbs -az, ferroin indicator solution-az, ferroin solution .ar.-az, ferrous ammonium sulfate-az, dichlorofluorescein 2,7 -az, acetocarmine-az, agar agar .bacteriological.-az, agarose-az, amino acid kit-az, ammonium ferrous sulfate-az, ammonium hydroxide solution-az, ammonium metavandate-az, ammonium persulphate-az, ammonium sulphate-az, anesthetic ether -az, anthrone-az, ascorbic acid-az, aspartic acid-az, barfords reagent -az, n.hexane - az, nin.hydrine - az, nitric acid .ar grade. - az, tolidine o - az, bromophenol blue - az, cerrous ammonium sulphate - az, cholestrol - az, colchicine - az, creatinin - az, creosote oil-az, cupric chloride-az, cylophosphamide-az, dipottasium hydrogen phosphate-az, disodium hyderogen phosphate-az, dmem media-az, lugol solution - az, may grenwalds stain - az, megnesium sulfate - az, merthyl orange indicator - az, methyl red indicator - az, methyl salycilate - az, mtt - az, n. butanol - az, naphthyl ethylinediamine dihydrochloride reagent - az, nessler.s reagent - az, phosphoric acid-az, pipette pump-az, pms.phenazine methosulfate-az., pnpp.para.nitrophenly phosphate disodium.-az, potassium dichromate-az, potassium dihydrogen phosphate-az, potassium hydrodide-az, pottasium dihydrogen phosphate.kh2po4.-az, pottasium hydrogen phosphate.k2hpo4-az., propionic acid-az, rbc diluting fluid-az, rpmi 1640 media-az, saline citrate-az, peptone-az, perchloric acid - az, petroleum ether - az, ph buffer capsules . 7.0 0.05. - az, food adulteration kit - az, glycerol - az, haematoxylin - az, hbss - az, hypochlorite - az, indigo carmine - az, isopropanol - az, leishman stain - az, sodium di.hydrogen phosphate-az, sodium hydroxide-az, sodium phosphate dibasic dihydrate-az, sodium potasssium tartarate-az, sodium succinate-az, stanous chloride-az, starch-az, sulphanilamide-az, sulpho salicylic acid-az, sulphuiric acid -az, thiurea-az, toluene -az, trichloro acitic acid.tca.-az, tris buffer-az, trisodium phosphate -az, wagners reagent-az, wbc diluting fluid-az, whatman filter paprer cat no.1001.125-az, whatman filter paprer cat no.1001.150-az, whatman filter paprer cat no.1001.185-az, benzene 1-az, ph buffer capsules .4.0 0.05.-az, ph buffer capsules .9.2 0.05.-az, phenol solution-az, phenopthalein indicator-az, phenyl alanine 4-az, potassium iodide 1-az, potassium permanganate 2-az, sodium azide 2-az, sodium chloride 2-az, sodium sulphate 3-az, sucrose 2-az,

CTN :39475182

04 Apr, 2025 NA

Raipur - Chhattisgarh

Tender For corrigendum : supply of edl & non edl, eye, x-ray medicines etc - acetazolamide tab.ip 250 mg, iv plasmalyte a 1000 ml (kabilyte), leishman's stain 25gm, levocarnitine 500 mg tablet, lidocaine (xylocaine)hcl 2% inj. 30ml, lidocaine 4% topical, ligaclip mlt 200, linezolid 600 mg tab, metoprolol 1mg/ml 5ml amp.inj., micronised progesterone 200mg tab., micronised progesterone sr 200mg tab, micronised progesterone sr 300mg tab, micronised purified flavonods fraction/ daflon 500 mg tab. (diosmin 450mg + hesperidine 50mg ), minoxidil 2% lotion, montelukast+levocetrizine tab., n - acetyl cysteine ( mucomix) 200mg/ml inj., n- acetylcysteine 600 mg, mucomix)tab, nitrofurantoin tab 100mg tab, non ionic mri contrast media 20 ml, normal saline 1000ml 0.9% i.v, normal saline 3% 100ml i.v, normal saline glass bottle 500 ml iv, ofloxacin400mg tab., pancreatin (cream)10000mg tab., pancuronium (povulon) 2mg/ml inj. 2ml amp., paracetamol 650mg tab., perindopril 8 mg +indapamide 2.5 mg tab., pilocarpine hydrochloride 4% eye drop, pioglitazone 15 mg tab., betamethasone 1mg tab., povidone iodine ointment 500 gm, procainamide 500mg, salbactum 1gm inj., scleral fixated iol (material pmma, optic diameter-6.5mm, overall diameter-6.5mm, equiconvex design, modified c loop haptics, holes in haptics for manipulation), septran (cotrimoxazole) 60 ml syp, septran trimethoprim cotromoxa tab 240 mg, sildenafil citrate 20 mg tab, sildenafil citrate 25 mg tab, silver sulphadiazine cream 250 gm, silver sulphadiazine cream 50 gm, sodium bicarbonate inj., sodium carboxy methyl cellulose eye drop 1% 10ml, sodium valproate 100mg/ml,5ml inj.(valproic acid), sodium valproate control release 500 mg tab, sofosbuvir 400 mg tab, streptokinase 1500000 iu injection, surgical spirit, tab. fluconazole, tadafil 5mg tab., tapentadol 50mg tab., telmisartan 40mg+ amlodipine 5 mg tab., thiopentone sodium 1gm inj., ticagrelor(brillnta) tab 90 mg, bosentan 62.5mg, torsemide 10mg tab., torsemide 20mg/2ml inj, torsemide 5mg tab., torsemide tab. 20mg, triamcinolone[kenacort] 40mg/ml inj., trihexyphenidyl tab 2mg, tropicamide0.8%+ phenylephrine eye drop 5% eye drop, trypan blue 0.15% dye, ursodeoxycholic acid( udiliv) 300mg tab., acyclovir ophthalmic 3% ointment, vancomycin 1g inj., vecuronium inj.5ml vial, verapamil hydrochloride 40mg tab., caffine 40 mg/2ml inj., captopril 25 mg tab, carbamazepine 300 mg tab, carbamazepine scored 200 mg tab, carbimazole 10 mg tab, carbonyl iron with zinc, sulphate &folic acid, carboprost 250mcg/ml inj., ahmed glaucoma valve(glaucoma drainage device), chlorthalidone 12.5 mg tab, cyclosporine preservative free eye drop 0.05%, cylinder trolley large, cylinder trolley medium, dapsone 100 mg tab, dicyclomine + paracetamol tab., digoxin 250 mcg inj., alcaftadine 0.25 % e / d, doxophylline 400 mg tab, d-panthenol gel 5%eye ointment, duloxetine m 20 mg tab, amikacin 500mg inj, esmolol hydrochloride 100mg inj., fenofibrate 145 mg, ferric carboxymaltose 1000 mg/20ml, ferrous sulphate 200 mg tablet, atropine + chloramphenicol + dexamethasone eye drop, flurbiprofen 0.03% eye drop, gliclazide 80mg, glimepride 1mg tab, glimepride 2mg tab, hemodialysis solution part a & b 5 litre, atropine sulfate tab., hepatitis b vaccine immunoglobulin 100 iu, heptagon tab., hydrocortisone inj (effcorlin), hydroxychloroquine 200 mg tab., hydroxyl propyl methyl cellulose 2% preservative free (visco elastic ) 5 ml, inj adalimumab 40 mg, inj aflibercept intravitreal 2mg / 0.05 ml, inj caspofungin 70 mg, insulin aspart 30% and insulin degludec 70% (rdna origin) solution for subcutaneous injection -100iu/ml , 3ml penfill, azelaic acid cream 10%, iris repositor, iron ( ferrous sulphate) and folic acid syp., iron ( ferrous sulphate)+ folic acid tab., iron sucrose 100 mg inj., iron sucrose 50mg inj., isi marked sodium hypochloride solution, iso amyl 2-cyanoacrylate glue, isotonic balanced crystalloid solution with calcium acetate and malate (sterofundin iso 500 ml ), isotretino

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

State Government

CTN :39834913

07 Apr, 2025 NA

Gurgaon - Haryana

Tender For supply of acetonitrile lcms grade , psa spe suitable , c18 spe suitable , magnesium sulfate anhydrous acs , phosphate buffer saline , sodium acetate anhydrous acs grade

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39796680

26 Mar, 2025 NA

Burdwan - West Bengal

Tender For supply of gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade , gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade

CTN :39792871

27 Mar, 2025 NA

Ezhimala - Kerala

Tender For procurement of expendable medical stores for echs polyclinics irt and kgd for qe jun 25 and sep 25 - betamethasone 0.1% + neomycin 0.5% oint, cabergoline 0.5 mg tab, cefaclor 250 mg tab, diclofenac + paracetamol + serratiopeptidase tab, empagliflozin (5mg) + metformin (500mg) tab, esomeprazole 40 mg + clarithromycin 500 mg + amoxicillin 750 mg (sompraz) cap, ondansetron 8 mg tab, pantoprazole 20 mg tab, rabeprazole 20mg +domeperidon 10mg tab, repaglinide 1mg tab, rifaximine 550 mg tab, rivaroxaban 2.5 mg tab, rivastigmine 3 mg tab, sildenafil 25 mg tab, silicon catheter 12 size, sterile gauze 10 cm x 10 cm 8 ply, syp ambroxyl (20mg/ 5ml) + dextromethorphan hydrobromide (10 mg/ 5ml) 100 ml, tab obeticholic acid 5 mg, tab rifaximine 200 mg, acetaminophen 325 mg + tramadol 37.5 mg (ultracet) tab, asthalin respules / levolin resp, coal tar + salicyclic acid lotion, disodium hydrogen citrate syrup 100 ml, duloxetine 10 tab, everolimus 0.5 mg tab, glimepiride 2 mg + metformin 500 mg sustained release tab, glimipride 2 mg + metformin sr 500 mg + voglibose, glipizide 5mg +metformin 500 mg tab, armodafinil 50 mg tab, calcium carbonate + calcitriol + methylcobalamine + vit k2 + zinc tab, glucosamine 500 mg +chondriotin 400 mg tab, methylcobalamine 500mg tab, pancreatin 10000 iu tab, nifedipine retard 10 mg tab, pioglitazone 30mg tab, aceclofenac 100 + serratio 15mg + pcm325mg tab, diclofenac 100 mg + metaxalone 400 mg tab, glibenclamide (2.5mg) tab, respule levosalbutamol 0.31 mg, risperidone 0.5 mg tab, rosuvastatin 10mg + aspirin 75mg tab, sodium valproate + valproic acid 200 mg tab, syp chlorpheniramine maleate 1 mg + paracetamol 125mg + phenylephrine 2.5mg of 60 ml bottle, tab sodium valproate 500 mg cr [sodium valproate(333mg)+valproic acid(145mg)], telmisartan 40 mg +chlorthalidone 12.5 mg tab, collagen peptide type 1, sodium hyaluronate, chondroitin sulfate & vit c tab (tendocare), thyroxine 37.5 mcg tab, torsemide 5 mg tab, carvedilol 12.5 mg tab, povidone iodine 10 % 15 gm oint, rivastigmine 1.5mg cap, salmeterol (50mcg) + fluticasone propionate (250mcg) [seretide accuhaler 50/250], tab metoclopramide 10 mg, tab pregablin 50 mg, miaps i2 crp kit of 30 test (agappe), lumber belt small, povidone iodine sol 10% bottle of 100 ml, timolol maleate 0.5% preservative free with comod system, carbidopa 18.75+levodopa 75 mg + entacapone 200 mg tab, canagliflozin 100 mg tab, quetiapine sr 100 mg tab

CTN :39796668

25 Mar, 2025 NA

Nadia - West Bengal

Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39222391

28 Mar, 2025 NA

Pune - Maharashtra

Tender For bid to ras supply of chemicals for preparaion of green primary explosives - 5 aminotetrazole monohydrate purity greater than 98 percent pack of 100 g as per qap no hemrl meg gpe rm 001 , copper ii sulfate pentahydrate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 002 , sulfuric acid purity greater than pack of 2 point 5 lit as per qap no hemrl meg gpe rm 004 , celite 545 purified calcined , ph equal to tilde 8 pack of 1 kg as per qap no hemrl meg gpe rm 005 , copper i chloride reagent plus purified purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 006 , 3 bromoanisole purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 007 , aminoguanidinium bvicarbonate purity greater than 98 percent pack of 500 g as per qap no hemrl meg gpe rm 008 , ammonium acetate acs reagent purity greater than 97 percent pack of 500 g as per qap no hemrl meg gpe rm 009 , silver nitrate acs reagent purity greater than 99 percent pack of 100 g as per qap no hemrl meg gpe rm 010 , ammonium iron iii sulfate dodecahydrate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 011 , ammonium thiocyanate acs reagent purity greater than 97 point 5 percent pack of 500 g as per qap no hemrl meg gpe rm 012 , 1 butanol acs reagent purity greater than 99 percent pack of 500 ml as pe qap no hemrl meg gpe rm 013 , glacial acetic acid acs reagent purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl meg gpe rm 014 , potassium dichromate acs reagent purity greater than 99 percent pack of 500 g as per qap no hemrl meg gpe rm 015 , sodium hydroxide purity greater than 98 percent pack of 500 g as per qap no hemrl qap naoh 2024 317 , acetone purity greater than 99 point 5 percent pack of 2 point 5 lit as per qap no hemrl qap rm acetone 2023 52 , isopropyl alcohol purity greater than 99 percent pack of 2 point 5 lit as per qap no hemrl qap rm ipa 2023 43 , potassium hydroxide purity greater than 85 percent pack of 500 g as per qap no hemrl qap koh 2024 319 , sodium azide purity greater than 99 percent pack of 500 g as per qap no hemrl qap sodium azide 2024 360 , nitric acid purity greater than 70 percent pack of 2 point 5 lit as per qap no hemrl qap rm nitric acid 2023 54 , sodium nitrite purity greater than 96 percent pack of 500 g as per qap no hemrl meg gpe rm 003

Central Government And Public Sector

CTN :39711374

15 Apr, 2025 4.97 Crore

Belgaum - Karnataka

Tender For tender for rate contract supply of drugs items to bims belagavi - zince oxide 20gm cream, zinc syrup 60 ml , xylometazoline 0.1% nasal drops 10ml, white petrolium 100% pure jelly 500gm, white petrolium 100% pure jelly 30gm, wax solvent ear-drops 10ml benzocaine 2.7%w/v+chlorbutol5%w/v+paradichlorobenzene2%w/v+turpentine oil-15%w/v, vitamin-e drops 50mg/1ml-15 ml, vitamin-d3 60000 iusachet, vitamin d3 400-iu 15ml (drops), vitamin b complex 200ml (syrup), vitamin a syrup (60 ml), vitamin a solution (100ml), ultra sound gel (5kg), turpentine oil (100ml), tropicamide- 5ml eye drops , triple combination cream (momethasone 0.25% with tretin 0.1% with hydroquinone 2.0%) 15 gm, triamcinolone 0.1% w/v 5gm oral ointment, tretinoin 0.025% cream , topical5% emla cream 15gm, topical lignocaine 25mg/g, prilocaine 25mg/g cream-5%- 5 gm (cream), tobramycine 0.3%10ml (eye drops), tincture benzoine (100ml), timolol maleate 10ml eye drops, thrombophobe ointment (20gm), theophylline with etophylline (200ml syrup), sucralphate (170ml syrup), soft roll (15cm x3mtr), soft roll (10cm x3mtr), sodium valproate 200mg/100ml (syrup), sodium phosphate enema (100 ml), sodium hypochloride 5-6% solution 5ltr, sodium hypochloride 5-6% solution 20litr, sodium chloride (nasal drops), sodium by carbonet ip 600gms with sodium-chloride ip 230gms t packets 1x830, silymarin l-ornithine l-asparatate (200 ml syp), silver sulphadiazine -15gm cream, silver sulphadiazine -100gm cream, sildenafil oral suspension 10 mg/ml, salbutamol-nebulisation repsules 2.5mg 2.5ml (amp), salbutamol- nebuliser solution (salbutamol 100microgram/actuation pressurised inhalation 200 actuations(pi,cmi)-15ml., salbutamol 2mg (100ml syrup), prednisolone acetate 1% + hpmc 0.25%-5 ml eye drop , povidone iodine solution in dark plastic bottle 500ml 5% w/v (500ml), povidone iodine ointment 5%w/v (15gm), povidone iodine ointment 5%w/v (125gm), povidone iodine cleansingsolution in dark plastic bottle 7.5 %w/v (500ml), potassium chloride (200ml syrup), pop roll 2.7 mtr x 15 cm (1roll), pop roll 2.7 mtr x 10 cm (1roll), phenytoin sodium 125mg (100ml syp), phenobarbiton 20 mg/5 ml-(100ml syp), permethrin 5% 30gm ointment, paracetamol 125mg/100ml (syrup), ors (who formula) 21gm, orodispersible probiotic sachets 2 gm-10 (sachets.), ondansetron 4mg/5ml 30ml (syrup), nuprep gel (114 gm), normal saline nasal 10ml drops, neomycin sulphate, polymyxin b sulfate and hydrocortisone 5 ml ear drop-, natamycin 5ml eye drops, mupirocin 2% 5gm ointment, multi vitamin with zinc 200ml (syrup), multi vitamin (zinc+b12+b-comp) drop-30ml, moxifloxacin 0.5%5ml eye drops, moxifloxacin 0.5% 5gm eye ointment , mometasone 1% 15gm (cream), micropore plaster size1.25cm x 9.1mtr 0.5 inch1roll (tissue plaster), micropore plaster size 7.5 cm x 9.1mtr 3inch 1roll(tissue plaster), micropore plaster size 2.5 cm x 9.1 mtr 1inch 1roll (tissue plaster), metronidazole 1.5% w/w -20gm gel, mefenamic acid with paracetamol 50+125mg/5ml 60ml (syp), mct oil 100ml (medium chain triglyceride (mct oil (100ml), luliconazole cream 1%w/v (10gm), liquid paraffin (60ml), lignocaine gel 2% (30gm), lignocaine 10% 50ml (spray), levetiracetam 100mg/ml (syrup), lactulose (200ml syrup), ketokonozol 2%with zinc payrithione 1% (100ml), ketoconazole 2% 20gm (cream), iron and folic acid-30 ml (drops), iron and folic acid (200ml syrup), ipratropium(500.0 mcg) + levosalbutamol / levalbuterol(1.25 mg) 3 ml (respules), hydrogen peroxide solution (100ml) amber bottle wrapped with black thick polybag with printed label 6% w/v, hmf sachet 2gm ( (lactodex hmf nutritional supplement sachet, 2 gm/sachet) sachet, haemocoagulase drops (10ml), glycin irrigation- (3ltr), glycerin-(100ml), glycerin & sodium chloride enema (20ml), glucose-sachets 75gm (dipsi-test), frusemide 10mg (30ml syp), framycetin sulphate 1% 10gm (skin cream), formoterol 6mcg with tiotropium 9mcg mdi 200 metered dose (inhalar), formaldehyde (5ltr), fluticasone propionate 50mcg (nasal spary) 120 meter d

Erbium Oxide Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

State Government

Central Government/Public Sector

State Government

Central Government And Public Sector