Latest ethylene glycol Tenders | Government ethylene glycol Tenders

Central Government/Public Sector

CTN :38243645

01 Apr, 2025 NA

Koraput - Odisha

Tender For bid to ras supply of supply, installation and commissioning of 18 tr mono ethylene glycol chiller as per detailed spec

CTN :39278045

31 Mar, 2025 3.65 Lacs

Rajauri - Jammu And Kashmir

Tender For bid to ras tender for supply of clindamycin phosphate 1% topical gel tube of 10 gm , clobetasol propionate cream 0.05% in tube of 10 gm , framycetin sulphate cream bp 1% cream 20 gm , glycerin ( glycerol) in bott of 1 kg , cream miconazole nitrate 2% skin tube of 15gm , permethrin 5% tube of 30 gm , terbinafine 1% cream tube of 10 gm , tretinoin 0.1% tube of 20 gm , tab valaclclovir hcl 500mg , clarithromycin 1% gel 15 gm tube , fusidic acid cream 2% w/w 10 g tube , para dichlorobenzene 2% w/v benzocaine 2.7% w/v chlorbutol 5% , turpentine oil 25 % w/v bott of 10 ml(waxol) , povidone iodine germicidal mouth wash 2% w/v bott of 60ml , chlorohexidine gluconate solution 5% , chlorhexidine gluconate solution equivalent to 4% w/v with isopropanol 10% ethoxylated alkyiphenol 10% 500ml bott with dispencer (500ml per bott) , povidone iodine 10% solution , bott of 500 ml , glutaraldehyde 2% aqueous sol with activator (cidex) , liquid antiseptic chlorhexidine gluconate bp 7.5% v/v cetrimide bp 15% w/v & alcohol 6-10% w/v solution 500 ml bott (savlon) , bacillus ciasuil 2 billion spores/5ml (enterogermina) , chlordiazepoxide (5mg)n+ clidinium (2.5mg) + dicyclomine (10mg) tab , antispasmodic tab containing mefenamic acid 250mg & dicyclomine hcl 10mg , levosulpride 25mg tab , entacavir 0.5 mg tab , trypsin with chymotrypsin 100000 armour units tab , metoclopramide syrup 5mg/5ml bott of 30 ml , dicyclomine hcl 20mg inj , tab/cap dicyclomine hcl 10mg , dextroprop oxyphen hcl 65mg acetamenophen ip 400mg , hyoscine bromide inj 20 mg/ml , 01 ml inj , mebeverine hcl ( 135mg) tabs , bisacodyl tab 5 mg (perpn tab) , tab hydrocortisone 20 mg , clotrimazole vaginal pessary 100mg , tab nor-ethisterone 5mg , inj magnesium sulphate 50% w/v , sitagliptine 50mg + metformin 1000mg tab , cough lozenges , neostigmine inj 0.5 mg in 1 ml ampoule , pyridostigmine tab 60 mg , succinylchloline chloride inj 50 mg/ml vial of 2 ml , vecuronium bromide inj 4mg/ml amp of 1 ml , tab calcium acetate 500 mg , protein supplement formula for renal patients , tacrolimus 1 mg tab , tacrolimus 0.5mg cap , tab sevelamer 400 mg tab , oint luliconazole 1% w/v tube of 30 gm , anti histamine syp each 5 ml containing diphenhydramine hcl 12.5mg , tab betahistine dihydro chloride 8mg , cinnarizine tab 25 mg , xylometazoline hcl 0.05% w/v nasal solution bott of 10ml , metronidazole susp 200 mg/5ml bott of 60 ml , ondansetron syp 2 mg/5 ml in bott of 30 ml , iron drops paediatric containing ferrous fumerate 25mg/ml vit b12 12.5mg/ml & folic acid 200mg/ml bott of 15ml , syrup calcium phosphate (80 mg/5 ml)200 ml bottle , tab alprazolam 0.25 mg , chlordiazepoxide 10 mg tab , clonazepam 0.5 mg tab , duloxetine 20 mg tab , fluoxetine hcl cap 20 mg , tab lorazepam 1 mg , tab risperidone 2 mg , tab acamprosate 333 mg , tab olanzapine 10 mg , tab sertraline 50mg , tab zolpidem 10 mg , formetrol 20mcg + budesonide 0.5mg respules , ipratropium bromide respirator soln 250 mcg/ml vial of 15ml , salbutamol sulphate respirator solution 5mg/ml , vial of 15 ml , titropium bromide 9mcg 120mtr dose inhaler , cough syrup each 5ml contains chlorpheniramine maleate ip 3mg , ammounium chloride ip 110mg , sodium citrate iop 46mg , menthol ip 0.9mg , syrup codeine phosphate 10 mg + chlorphenaramine maleate 4 mh per 5 ml bottle of 100 ml , syrup tabutaline sulphate 1.25 mg + bromphexine hcl 4 mg + guaphenesin 50 mg per 5 ml bottle of 100 ml , dextrose monohydrate for oral use pkt of 100gm

CTN :39863149

28 Apr, 2025 18.00 Lacs

Kamptee - Maharashtra

Tender For supply of generic medicines at cantonment general hospital, kamptee cantt - ecg gel 5 liter jar, adhesive tape 7.5 cm x 5 meters, asthaline inhaler (200 dosages) 100 micro gm/dose, bandage cloth 100cm x 16 meters (super fine), beclate inhaler (200 dosages) 200 micro gm/dose, capsules pre and probiotic, ciprofloxacin + dexamethasone eye drop, ciprofloxacin eye drop, cotton absorbant 500 gm, diclofenac ointment 30 gm, disposable large size gloves box, disposable needle no. 24 (bd), disposable syringe 10 ml (dispovan), disposable syringe 2 ml (dispovan), disposable syringe 5 ml (dispovan), electrol powder (5 sachet) 5 gm, framycetin sulphate cream 100g, gbhc, i. v. d.n.s. 500 ml (baxter), i. v. dextrose 5% 500 ml (baxter), i. v. ringer lactate 500 ml (baxter), i. v. set (romsons), i.v n.s 500 ml, i.v ns 100ml, inj hyoscine butylbromide 2 ml, inj. amikacin 500 mg, inj. ampicillin 250 + cloxacillin 250 + 250, inj. b-complex (10 ml), inj. dexamethasone 02 ml, inj. diclofenac sodium 1 ml 75 mg, inj. etofyline & theophylline, inj. ondensetron 20 ml vial, inj. pantaprozole 40mg, inj. ranitidine 2 ml, inj. tetanus toxoid 5ml vial, inj. vitcofol (10 ml) (fdc), inj. water sterile for inj. 5 ml, injection anaforton 20 ml, injection febrinil 10 ml, injection vitcofol c (fdc) 2ml, iv isolyte-p (baxter) 500 ml, lactic acid bacillus 1 gm sacchettes, neosporin powder 30 gms, oint ketoconazole (30mg), povidone iodine 500 ml, salbutamol solution respirator, scalp vein set no. 22 (romsons), sumag ointment 75 gms, sup albendezole 10 ml, surgical blade no. 11, syp ibuprofen + pcm 60 ml, syp ondencetron 30 ml, syp. amoxycillin + clavulanic acid 228.5 mg/5ml oral suspension (200 mg), syp. azithromycin 15ml (200 mg), syp. chlorpheniramine + pcm + phenylephrine 60 ml, syp. ofloxacin & metronidazole 30 ml, syp. paracetemol 60 ml (250 mg), syp. terbutaline 100 ml + bromhexine, tab aceclofenac + pcm + serratiopeptidase, tab albendazole + ivermectin, tab alprazolam 0.25 mg, tab aluminium & magnesium hydroxide, tab amlodipine 5 mg, tab amoxycillin & potassium clavulanate 625 mg, tab aspirin 150 mg, tab azithromycin 500 mg, tab b. complex, tab clopidogrel 75 mg, tab doxyphylline 100 mg, tab etofyline & theophylline 100 mg, tab flucanazole 150 mg, tab glimepride 1 mg + metformin 500 mg, tab glimepride 2 mg + metformin 500 mg, tab hyoscine butybromide (2mg), tab ibuprofen 200 mg, tab levcetrizine, tab limcee 500 mg (chewable), tab mefenamic acid 250 mg + dicyclomine hcl 10 mg, tab metoprolol succinate 25 mg, tab metronidazole 200 mg, tab montelukast -l, tab nifedipine 10 mg, tab nitrofurantion 100 mg, tab ofloxacin 200 mg, tab pantaprazole 40 mg + domeperidone 10 mg, tab pantoprazole 40 mg, tab paracetamol 500mg & metoclopramide 5mg, tab paracetemol 500 mg, tab pcm 500 mg + cetrizine 5 mg + phenyllephrine 10 mg, tab pheniramine maleate 25mg, tab prochlorperazine (stemetil), tab ranitidine 150 mg, tab rifaximine 400 mg, tab salbutamol 2 mg, tab telmisartan 40 mg, tab terbutaline + bromhexine, tab tramedol + pcm, tan ondencetron md 4 mg, tab c.t.d 6.25 mg, tab calcium citrate +vitd3, tab paracetamol 600 mg, tab ferrous sulphate, inj rabipur

corporations/Associations/Others

CTN :38988703

31 Mar, 2025 64.31 Lacs

Bangalore - Karnataka

Tender For bid to ras supply of drugs - solution oral caffiene , inj caffiene citrate , inj hyaluronidase 1500iu freeze dried powder , injection cerebrolysin 215.2mg per ml , injection hyaluronidase 48mg 6ml , inj hyaluronidase 3% wv 90mg 3ml penfilled syringe , inj magnesium sulphate 5opercentage , hypromellose opthalmic solution 2% w/v , inj sodium hyaluronate opthalmic solution 1.6% w/v , inj trypan blue solution 0.06%w/v , inj lorazepam 2mg/ml , inj haloperidol 5mg/ml , spray benzocaine 0.36% w/w + cetrimide 0.5%w/w , inj actinomycin d 0.5mg , inj degarelix 120mg , inj degarelix 80mg , inj doxorubicin 50mg , inj eribulin 0.5mg , inj irinotecan 100mg , inj irinotecan 40mg , inj leuprolide 22.5mg , inj doxorubucin 20mg , inj oxaliplatin 100mg , inj darbapoietin alpha 500mcg , inj multiple electrolyte solution 500ml bag , inj botilinium toxin 100iu , inj l-ornithine l-aspartate infusion 5mg/100ml , inj phenylephrine 10mg/ml , inj pralidoxime iodine 500mg 25mg/ml , 500mg in 20ml , inj romiplastin 500mcg/ml , inj doxycyclin 100mg , iv normal saline 500ml glass bottle 0.9% w/v , iv sterile water 500ml , iv ringer lactate 500ml glass bottle , inj buprenorphine 0.3mg/ml , inj clonidine 150mcg/ml , inj ephedrine 30mg/ml , inj etomidate 2mg/ml , inj hydroxyethylstarch 500ml , inj lignocaine 4% , inj mephentaramine 30mg/ml , inj glycopyrrolate 0.5mg + neostigmine methylsulphate 2.5mg , inj thiopental 1gm , 3.5% colloidal infusion of polygeline with electrolytes for iv administration 500ml , iv sevoflurane , spray lidocaine 10% , inj ropivacaine 0.25% , inj ropivacaine 0.75% , inj vecuronium 10mg/puff , inj ketamine 50mg/ml , inj nalbupine 10mg/ml , transdermal patch fentanyl 12.5mcg , transdermal patch fentanyl 25mcg , aminoacid solution 10% for intravenous infusion

CTN :39846939

17 Apr, 2025 NA

Amritsar - Punjab

Tender For tender for supply of akash ars spares - isoplex topaz grease 1kg pack , de ioniser cartridge , ethylene glycol fluid , air filter element primary , mollicut grease , castrol spheerol ap 3 , de oxidizer cartridge , oil alpha sys ep 320 , oks 9480 grease , rr3 grease , grease castrol , grease mobil , grease thk

CTN :39846983

17 Apr, 2025 NA

Belgaum - Karnataka

Tender For supply of drug and medicine - chlordiazepoxide 10mg tab , doxepin 25 mg cap , clomipramine hcl 25 mg tab , clozapine 100 mg tab , duloxetine 20 mg tab , doxepin hcl 75 mg cap , fluoxetine hcl 20 mg cap , haloperidol 5 mg tab , lorazepam 1 mg tab , lithium carbonate 300 mg cap tab , clonazepam 0 point 25 mg tab , clozapine 25 mg tab , desvenlafaxine 50 mg tab , etizolam 0 point 5 mg tab , risperidone 2 mg tab , aripiprazole 10 mg tab , atomoxetime 10 mg tab , olanzapine 10 mg tab , venlafaxine 75 mg tab , sertraline 50 mg tab , zolpidem 10 mg tab , quetiapine 50 mg tab , paroxetine xr 12 point 5 tab , tab amisulpride 200 mg , quetiapine 25 mg tab , sertraline 100 mg tab , glycopyrronium 25 mcg smartules , etophylline bp 84 point 7mg theophylline 25 point 3 per ml 2 ml inj , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per cfc free mdi , cap nintedanib 150 mg , cap nintedanib 100 mg , levosalbutamol sulphate 2 point 5 ml containing 1 point 25 mg respule , tiotropium bromide 9 mcg 120 metered doses unit inhaler , tiotropium bromide 18 mcg formoterol 12 mcg dry powder cap , budesonide 200 mcg dry powder , formoterol 12 mcg fluticasone 250 mcg dry powder , tiotropium bromide 18 mcg dry powder cap , terbutaline 1 point 25 mg bromhexine 4 mg guaiphenesin 50 mg per 5 ml bott 100 ml syp , dextrose 5 percent 25 ml inj , dextrose inj 25 percent 25 ml inj , sterile water for amp of 10 ml , tab cap mirabegron 25 mg , silodosin 4 mg tab , anti phlebitis cream tube of 15g 20g , povidone iodine 10 percent solution bott of 100 ml , enteral feed pdr protein 85 peptides 15 fat 50 mct 25 85 15 50 25 percent sachet 126 gm , cilostazole tab 100 mg , sildenafil citrate 50 mg tab , tolteridone tartrate 2 mg tab , drotaverine hcl 40 mg tab , finasteride 5 mg tab , vitamin b complex vit b1 5mg vit b6 3mg vit b12 5mcg therapeutic tabcap , vitamin b 12 500 mcg ml inj , iron syp paediatric 5 ml elemental iron 25 50 mg folic acid 500mcg bottle of 200ml , multi vit inj iv thiamine 30mgml pyridoxine 30mg ml cyanocobalamin 300 mcgml 2 to 10ml , dapaglifozin 5 mg tab , fluticasone propionate inhaler for adults 125 mcg dose , salmetrol 50mcg fluticasone 250mcg pdr 30 60 100 doses pdr inhaler , colchicine 0 point 5mg tab , capsacain gel tube of 20 gm , glucosamine 250mg chondroitin sulphate 200 mg cap , ibuprofen gel tube of 20 gm , leflunomide 10 mg tab , nimesulide gel tube of 20 gm , methylprednisolone 4 mg tab , clindamycin 300 mg cap , sulphamethoxazole 400 mg trimethoprim 80mg tab , acyclovir 200 mg tab , emtricitabine 200 mg tenofovir 300mg tab , lamivudine 150 mg tab , efavirenz 600 mg tab , zidovudine tab 300 mg , zidovudine 300mg lamivudine 150mg nevirapine 200mg tab , nitrofurantoin 100 mg cap , clozapine 50 mg tab , bisoprolol 2 point 5mg tab , carvedilol 6 point 25 mg tab , olmesartan 20 mg tab , propanolol 10 mg tab , trimetazidine mr 35 mg tab , gliclazide 40 mg tab , voglibose 0 pont 3 mg tab , tab ornidazole 500 mg , tenofovir 300 emtricitabine 200mg efavirenz 600mg tab , hepatitis b vaccine 10 ml , cell culture rabies vaccine vial of 1 ml , tetanus toxoid purified absorbed rubber capped vial of 5 ml , syp iron with vitamin b12 and folic acid bott of 200 ml , syp lactulose each 5ml containing 3 point 325g bott of 200ml , syp liquid paraffin 1 pont 25 magnesium hcl 3 point 75 sodium picosulphate 200 ml bott , syp multivitamin multiminerals bott of 200 ml

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :38802295

31 Mar, 2025 NA

Thiruvananthapuram - Kerala

Tender For corrigendum : supply of ethylene glycol tetraacetic acid - egta , lactobionic acid , taurine 25 g , sucrose , pottasium dihydrogen orthophosphate , hepes buffer 100g

CTN :39498757

28 Mar, 2025 NA

Ganganagar - Rajasthan

Tender For bid to ras bid to ras tender for supply of pramipexole 0 point 5 mg tab , prasugrel 10 mg tab , prasugrel 5 mg tab , prazocin sr 2 point 5 mg tab , prazocin sr 5 mg tab , prednisolone 20 mg tab , prednisolone 5 mg tab , pregabalin 75 mg plus nortriptyline 10 mg tab , pregabalin 75 mg plus methylcobalamin 1500 mg tab , pregabalin 75 mg , pre probiotc tab , propranolol 10 mg tab , propranolol 20 mg tab , propranolol tr 40 mg tab , protein powder pack or tin of 200 gm , quetiapine 50 mg tab , rabeprazole 20 mg tab , rabeprazole 20mg plus itopride 50mg tab , rabeprazole 20 mg plus domperidone 30 mg sustained release tab , ramipril 10 mg tab , ramipril 2 point 5 mg tab , ramipril 5 mg tab , ranitidine hcl 50 mg amp of 2 ml inj , repaglinide 0 point 5 mg tab , respule levosalbutamol 1 point 25 mg in 2 point 5 ml , rifaximin 550 mg tab , ripasudil 0 point 4 percent w by v bott of 5 ml eye drops , risperidone 1 mg tab , risperidone 2 mg tab , risperidone 4 mg plus trihexephenedyl 2 mg tab , rivoraxaban 20 mg tab , roller bandage open woven uncompressed 10 cm x 4 metres , roller bandage open wove uncompressed 6 cm x 4 metres , rosuvastatin 10 mg plus fenofibrate 160 mg tab , rosuvastatin 10 mg tab , rosuvastatin 20 mg tab , rosuvastatin 40 mg tab , rotacap salmeterol 50 mcg plus fluticasone 250 mcg , rotahaler , saccharomyces boulardii 250 mg cap , sachet pre probiotic fructooligosaccharide plus bifidobacterium plus streptococcus plus lactobacillus , salbutamol 200 mdi each metered dose supplies 100 mcg of salbutamol mdi , salmeterol 50 mcg plus fluticasone propionate 250 mcg seretide accuhaler , saroglitazar 4 mg tab , sertraline 50 mg tab , sevelamer 400 mg tab , sgot kit erba , sgpt kit erba , silodosin 4 mg tab , silodosin 8 mg cap , silver sufadiazine oint 1 percent tube of 20 gm , sitagliptin 50 mg tab , sitagliptin 50 mg tab plus metformin 1000 mg tab , sitagliptin 50mg tab plus metformin 500mg tab , sodium bicarbonate 1000 mg tab , sodium bicarbonate 500 mg tab , tab sodium valproate 300 mg cr , solifenacin 10 mg tab , spironolactone 25 mg tab , spironolactone 50 mg , sucralfate suspension 1gm per 5ml bott of 200 ml , sulphacetamide 20 percent w by v eye drops amber bottle with self dropper bott of 10 ml , sulphasalazine 1 gm tab , sumitriptan 50 mg tab , syp iron with vitamin b12 and folic acid bottle of 200 ml , syp paracetamol 162 mg plus ibuprofen 100 mg 60 ml suspension , syp cyproheptadine hcl 2 mg per 5 ml bott of 100 ml , syp potassium citrate 1100mg plus citric acid or magnesium citrate 300 to 400mg per 5 ml bott of 100 ml , syp tricholine citrate 0 point 55 mg plus sorbitol 7 point 15 gm per 10 ml bott of 200 ml , syringe disposable sterile 10 ml with needle , syringe disposable plastic 20 ml with needle , syringe disposable plastic sterile 2 ml with needle , syringe disposable plastic 3 ml with needle , syringe disposable plastic sterile 5 ml with needle , tadalafil 5 mg tab , tamsulosin 0 point 4 mg plus dutasteride 0 point 5 mg tab , tamsulosin 0 point 4 mg tab , taurine 500 mg plus acetylcystine 150 mg tab , telmisartan 20 mg tab , telmisartan 80 mg tab , telmisartan 40 mg plus hydrochlorothiazide 12 point 5 mg tab , teneligliptin 20 mg plus metformin 500 mg tab , teneligliptin 20 mg tab , tennis elbow support , tenofovir alafenamide 25 mg tab , terbinafine 250mg tab , terbinafine 1 percent cream tube of 10 gm , thalidomide 50 mg tab , thiocolchicoside 4 mg tab , thyroxine 100 mcg tab , thyroxine 12 point 5 mcg , thyroxine 125 mcg tab , thyroxine 150 mcg tab , thyroxine 25 mcg tab , thyroxine 50 mcg tab , thyroxine 75 mcg tab , timolol maleate 0 point 05 percent eye drop bott of 5 ml , tinidazole 500 mg tab , tiotropium 18 mcg rotacap , tiotropium bromide 9 mcg 120 metered doses per unit inhaler , tofacitinib 5 mg tab , tolperisone sr 150 mg tab , tolterodine 2 mg tab , tolterodine 4 mg tab , tolvaptan 15 mg tab , torsemide 100 mg tab , torsemide 10 mg plus spironolactone 50 mg tab , torsemide 10 mg tab , torsemid

Ethylene Glycol Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

corporations/Associations/Others

Central Government/Public Sector

State Government