Latest furoseminde tab Tenders | Government furoseminde tab Tenders

CTN :38848379

03 Apr, 2025 22.14 Lacs

Kamrup - Assam

Tender For supply of tab etoricoxib 90 mg , gabapentin 400 mg cap , tab etoricoxib 120mg , cap gabapentin 400mg plus nortriptyline 10mg , cap pregabalin 75 mg , pancreatin enzyme 1000 unit cap , sofosbuvir plus velpatasavir 400slash100 mg , tab zinc 50mg , polyethylene glycol 3350 plus isapghula husk powder pkt of 154dot8g , polyethlene glycol 17dot5 gm , 5 amino salicylic acid 800 mg tab , tab prucalopride 2mg , tab nitazoxanide 500mg , mesalamine suppositories mesacol suppositories 1gm , lidocain topical aerosol 10 percent spray , l leucine 2760mg plus l isoleucine1920mg plusl valine 1656mg slash 10gm sachets , obeticholic acid 10mg tab , pantoprazole 40 mg plus itopride 50 mg cap , pantoprazole 40mg plus domperidone 10mg tab , rabeprazole 20 mg plus domperidone 30 mg cap , rabeprazole 20 mg plus itopride 150 mg sr tab , rifaxamine 200 mg tab , ursodeoxycholic acid 300 mg tab , ursodeoxycholic acid 600 mg tab , vit e 400 mg cap , vitamin d3 60000iu cap , 5 amino salicylic acid sr 400mg tab , sodium picosulphate 5 mg per 5 ml bott of 100 ml syp , disinfecting and sterilising solution for surgical instruments 2percent glutaraldehyde solution with activator can of 5 ltr , itopride 150 mg sr tab , albumin powder 400gm , cholestyramine 4gmslash5gm , inj anidulafungin 100mg , pancreatic enzyme supplement 25000 units of lipase , pancreatin minimicrosphere smart device 30 gm , azathioprine 50mg tab , diclofenac sodium suppository 100 mg , tab sofosbuvir 400mg , daclatasvir 60mg tab , sofosbuvir 400mg plus ladipasvir 90mg , mesalazine 2gm sachet , carvedilol tab 3dot125mg , fenofibrate 200 mg tab , propranolol tr 40 mg tab , enzymatic detergent solution containing bacterial protease 8dot5percent per 100ml can of 3dot78 litre , sodium hypochlorite 5percent , 2 propanol 45gm 1 propanol 30 gm ethyl hexadecyl dimethyl ammonium ethyl sulphate 0dot2 gm with skin protecting substances 500 ml bott with dispenserdot , 0dot5percent wslashv chlorhexidine gluconate in 70percent vslashv ethyl alcohol with moisturizer 500 ml bott with dispenser , chlorehexidine solution containing chlorhexidine gluconate bp 7dot5 percent v vcetrimide 15 percent wv 500 ml bottdot , frusemide 40mg tab , l ornithine l asparate powder 5 gm , ribavirin 200 mg cap , mesalamine suppository 500 mg , pancreatic enzymes supplement with a lipase content of 25000 units or more cap , n butylcyanocrylate glue 0dot5ml , tab levosulpiride 25 mg , entacavir 0dot5 mg tab , clarithromycin 500 mg tab , lactic acid bacillus sachet , ranitidine hcl ip 300 mg tab , 5 amino salicylic acid enema 4g mesacol , hydrocortisone enema 10percent wslashw , dicyclomine hcl 20mg inj , mebeverine hcl 135mg tabs , sodium phoshate ml 6percent sod acid phoshate 16percent pack of 100ml enema , isabgol husk 3dot5 gm , bisacodyl tab 5 mg , sodium phosphate solution 45 ml each pack of 2 bott perpn ml , pancreatic enzyme capsules with a lipase content of 10000 to 20000 units , simethicone 80mg and charcoal 400 mg tab , prednisolone 20 mg tab , tab calcium acetate 500 mg , chlordiazepoxide 10 mg tab , escitalopram 10 mg tab , dextrose 50percent 25 ml inj , dextrose inj 25percent in amp of 25 ml , sulphasalazine 1000 mg delayed released , inj diclofenac 75 mgslashml 1 ml amp for iv bolus , hbv vaccine 1 ml , hepatitis b human immunoglobuline hbig , hepatitis b vaccine 10 ml , acetone commercial

CTN :39881293

22 Apr, 2025 9.49 Lacs

Darjeeling - West Bengal

Tender For supply of d ifa re 13 decapeptide 10mg lot 10ml bott , d ifa re 13 diphtheria tetanus acellular pertussisdtap single dose vaccine , d ifa re 13 inj gadobutrol 1dot0mmolml 10ml vial , d ifa re 13 umbilical catheter 3dot5 fr , d ifa re 13 tracheostomy tube 8mm with cuff and two inner cannula , d ifa re 13 sodium perborate monohydrate 50 ww solution parasafe , d ifa re 13 inj noval rabies monoclonal antibody containing docaravimav and miromavimab 1500iu2dot5ml , d ifa re 13 locking reconstruction plate 3dot5mm titanium 14 hole with twelve 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 10 hole with ten 3dot5mm locking head titanium screws , d ifa re 13 locking reconstruction plate 3dot5mm titanium 12 hole with twelve 3dot5mm locking head screws , d ifa re 13 neonatal central venous triple lumen catheter central line size2dot5fr , d ifa re 13 cpap disposable tubing with water chamber and humidifier chamber , d ifa re 13 bipolar marryland vessel sealer 5mm , d ifa re 13 neonatal central venous triple lumen catheter central line size3dot0fr , d ifa re 13 endopath endoscopic bowl clamp with ratchet , d ifa re 13 disposable perforator for craniotomy atraumatic tip 14mm , d ifa re 13 thalidomide 100mg cap , d ifa re 13 antimicrobial skin cleaning wipes polyhexanide based pack of 1012 wipes , d ifa re 13 vitb complex forte with ascorbic acid cap , d ifa re 13 cyclosporine 50mg tabcap , d ifa re 13 thiocolchicoside 4mg captab , d ifa re 13 vit d3 100 iu folic acid 1mg mayoinositol 2000mg sachet5 gm each pack of 30 , d ifa re 13 glycolic acid 6 cream 30 gm tube , d ifa re 13 octinoxateniacinamideglycolic acid 3kojic acid dipalmitatearbutinmulberry extract1 tocopheryl acetateallantoinlicoric extract tetrahydrocurcumin30gm , d ifa re 13 crystal trichloroacitic acid 100 , d ifa re 13 gel sunscreen gel spf40 60gmoctinoxatediethylamino hydrobenzoyl hexyl benzoatebisethyloxyphenol methoxyphenyl microfine , d ifa re 13 hair rremoval contains watermineral full nomenclature in pdf format , d ifa re 13 hand disinfectant 32dot5 gm propanolol1 18 gm etahol 0dot1 gm glutaraldehyde bott of 250 ml liq , d ifa re 13 liquid disinfectant each 05 lit contains sodium chloride 605 gm potassium chloride 10 gm sod bi carbonate 15 gm in buffer solution qs and stabilizer qs can of 5 ltrsterisol , d ifa re 13 betamethasone 0dot05 zinc sulfate 0dot5 lotion 50ml bott , d ifa re 13 desonide 0dot05 ww gel 20gm , d ifa re 13 paracetamol 500mg caffeine 65mg tab , d ifa re 13 neomycin pulv bott 5 gm , d ifa re 13 serum vit k under eye serum 30 ml , d ifa re 13 ketoconazole ichthyal pale dpanthenol alovera 10 75ml shampoo , d ifa re 13 diazepam suppository , d ifa re 13 paracetamol 250mg suppository , d ifa re 13 surgical scrub 2 chlorhexidine in 70 ethyl alcohol without any moisturizers bott of 500 ml , d ifa re 13 cefpodoxime oral suspension , d ifa re 13 ofloxacin orinidazole syp 30 ml bottle , d ifa re 13 oseltamivir 12mgml syp , d ifa re 13 alfuzocin 10mg dutasteride 0dot5mg tab , d ifa re 13 amoxycillin 250mg clavulanic acid 50mg tab , d ifa re 13 calcium carbonate 250 tab , d ifa re 13 itopride 100mg tab , d ifa re 13 chlordiazepoxide 5mg clinidium 2dot5mg tab , d ifa re 13 mesalamine 200mg tab , d ifa re 13 metalozone 5mg tab , d ifa re 13 montelukast 10mg tab bid details/ 2 / 46

CTN :39222825

31 Mar, 2025 17.13 Lacs

Ferozepur - Punjab

Tender For bid to ras bid to ras bid to ras tender for supply of bupivacaine hcl 5 mg ml heavy 4 ml inj , diclofenac diethylamine 2.32 quick penetrating topical solution30 ml bottle with metered dose spray , tab topiramate 50mg , artesunate 60mg inj , tab levodopa cr 250 mg , tab fenofibrate 160 mg , fenofibrate 200 mg tab , lignocaine hcl solution 2 percentage for iv use 50 ml inj , labetalol hcl 100 mg tab , labetalol hcl 5mg ml 4ml inj , para dichlorobenzene 2 per w v benzocaine 2.7 per w v chlorbutol 5 perturpentine oil 15 per bott of 10 ml , chlorhexidine gluconate 2 per in 70 per isopropyl alcohol 500 ml bott , glutaraldehyde 2 per with opa with checking strips , povidone iodine solution 5 per bottle of 100 ml , cilnidipine 5 mg tab , tab entacavir 0.5 mg , pantoprazole 40mg plus domperidone 10mg sr , carboprost tromethamine 250 mcg ml 1ml inj , oxytocin 5 units per 1.0ml amp inj , human insulin analogue glargine inj , 100 iu ml recombinant dna origin 300iu disposable pen with 5 needles per pen , olaptadine hcl 0.1 per eye drop with drop dispensor technology bott 5ml , alprazolam 0.25 mg tab , lorazepam 1 mg tab , levosalbutamol sulphate 2.5 ml containing 1.25 mg respule , tiotropium bromide 9 mcg 120 metered dose inhaler , salmeterol 50 mcg plus fluticasone 250 mcg multi dose dry powder inhaler of 60 doses , nitrofurantoin 100 mg tab , tetanus toxoid purified absorbed vaccine 0.5ml , tube endo tracheal reinforced pvc size 7.0 with cuff , tube endo tracheal reinforced pvc size 7.5 with cuff , bandage full arm lymphoedema sleeve small classiii 34 46mm hg , bandage full arm lymphoedema sleeve medium class iii 34 46mm hg , bandage full arm lymphoedema sleeve large , comfort caps , lint absorbent cotton , set infusion microdrip presterilised disposable for paediatric use consisting of nontoxic pvc tubing 1700mm with drip chamber of minimum 1000ml , syp osteo calcium bott of 200 ml , tab mecobalamin folic acid pyridoxine b1 b6 , inj neurobion , tab neurobion , fas kit , ecg roll large , troponin t test card , tab premipaxole 0.25 , tab paroxetine , spacer device , tab feropenum 60 mg , eye drape , urostomy kit , syphilis rapid kit , tab leflunomide 20mg , tab misoprostol 200 mg , cap omega 3 f acid m vitamin minerals anti oxidant soft gel , eye drop systane dehydration , tab nitroglycerin 2.6 mg , troponin i test , automatic developer , tab clinidipine 10 mg , sulphamethoxazole 400 mg trimethoprim 80mg tab , ketamine hcl 50 mg ml 2 ml inj , vecuronium bromide 4mg ml 1 ml inj , hydrochlorothiazide 25mg , suture sterilised surg nedled suture polyglactine 910 fast absobable size 1 0 half half cicle tapper cut 40 mm double arm , inj nitroglycerine glyceryltrinitrate 5 mg , trypsin with chymotrypsin tab , levetiracetam 100mg ml vial of 5 ml inj , nortriptyline 25 mg tab , suspensory scrotal , bandage triangular , bandage t shaped , hfnc paediatric circuits hioxy 1570s , hfnc adult circuits hioxy 1570s , surgical gun , inj hcg 5000 , syp multivitamin , rifampicin 150mg cap , tab aceclofenac paracetamol serratiopeptidase , suture vicryl 2 by 0 fast absorb , desmopressin 0.2 mg tab , cholin salicylic acid mouth ulcer gel , mesalazine 2gm sachet , syp ambroxol plus guipheneson , trihexyphenidyl hcl 2 mg tab , atropine sulphate 0.6 mg 1 ml inj , common cold tab cetrizine 5mg paracetamol 500 mg pseudoephedrine 30 to 60mg , tab thalidomide 50mg , ethinyl estradiol 0.035mg cyproterone acetate 2mg pack of 21tablets , dinoprostone gel 0.5mg in 3gm 2.5ml gel syringe , sodium hypochlorite 5 percentage , laryngoscope cells for. size aaa , sodium chloride 3 per inj bott of 100 ml , aa battery , dynapar spray , tetracyclin ip 500 mg cap , cyclosporine a micro emulsion 25 mg cap , cyclosporine a micro emulsion 100 mg cap , clonidine 100 mcg tab , bacillus clausii 2 billion spores 5 ml , metoclopramide hcl 5mg ml 2ml inj , syp sucralfate 1000 mg 10 ml plus oxetacaine 10 mg 10ml bottle of 100 ml , drotaverine hcl 1 per 20 mg ml 2 ml inj , delivery system for

CTN :39278045

31 Mar, 2025 3.65 Lacs

Rajauri - Jammu And Kashmir

Tender For bid to ras tender for supply of clindamycin phosphate 1% topical gel tube of 10 gm , clobetasol propionate cream 0.05% in tube of 10 gm , framycetin sulphate cream bp 1% cream 20 gm , glycerin ( glycerol) in bott of 1 kg , cream miconazole nitrate 2% skin tube of 15gm , permethrin 5% tube of 30 gm , terbinafine 1% cream tube of 10 gm , tretinoin 0.1% tube of 20 gm , tab valaclclovir hcl 500mg , clarithromycin 1% gel 15 gm tube , fusidic acid cream 2% w/w 10 g tube , para dichlorobenzene 2% w/v benzocaine 2.7% w/v chlorbutol 5% , turpentine oil 25 % w/v bott of 10 ml(waxol) , povidone iodine germicidal mouth wash 2% w/v bott of 60ml , chlorohexidine gluconate solution 5% , chlorhexidine gluconate solution equivalent to 4% w/v with isopropanol 10% ethoxylated alkyiphenol 10% 500ml bott with dispencer (500ml per bott) , povidone iodine 10% solution , bott of 500 ml , glutaraldehyde 2% aqueous sol with activator (cidex) , liquid antiseptic chlorhexidine gluconate bp 7.5% v/v cetrimide bp 15% w/v & alcohol 6-10% w/v solution 500 ml bott (savlon) , bacillus ciasuil 2 billion spores/5ml (enterogermina) , chlordiazepoxide (5mg)n+ clidinium (2.5mg) + dicyclomine (10mg) tab , antispasmodic tab containing mefenamic acid 250mg & dicyclomine hcl 10mg , levosulpride 25mg tab , entacavir 0.5 mg tab , trypsin with chymotrypsin 100000 armour units tab , metoclopramide syrup 5mg/5ml bott of 30 ml , dicyclomine hcl 20mg inj , tab/cap dicyclomine hcl 10mg , dextroprop oxyphen hcl 65mg acetamenophen ip 400mg , hyoscine bromide inj 20 mg/ml , 01 ml inj , mebeverine hcl ( 135mg) tabs , bisacodyl tab 5 mg (perpn tab) , tab hydrocortisone 20 mg , clotrimazole vaginal pessary 100mg , tab nor-ethisterone 5mg , inj magnesium sulphate 50% w/v , sitagliptine 50mg + metformin 1000mg tab , cough lozenges , neostigmine inj 0.5 mg in 1 ml ampoule , pyridostigmine tab 60 mg , succinylchloline chloride inj 50 mg/ml vial of 2 ml , vecuronium bromide inj 4mg/ml amp of 1 ml , tab calcium acetate 500 mg , protein supplement formula for renal patients , tacrolimus 1 mg tab , tacrolimus 0.5mg cap , tab sevelamer 400 mg tab , oint luliconazole 1% w/v tube of 30 gm , anti histamine syp each 5 ml containing diphenhydramine hcl 12.5mg , tab betahistine dihydro chloride 8mg , cinnarizine tab 25 mg , xylometazoline hcl 0.05% w/v nasal solution bott of 10ml , metronidazole susp 200 mg/5ml bott of 60 ml , ondansetron syp 2 mg/5 ml in bott of 30 ml , iron drops paediatric containing ferrous fumerate 25mg/ml vit b12 12.5mg/ml & folic acid 200mg/ml bott of 15ml , syrup calcium phosphate (80 mg/5 ml)200 ml bottle , tab alprazolam 0.25 mg , chlordiazepoxide 10 mg tab , clonazepam 0.5 mg tab , duloxetine 20 mg tab , fluoxetine hcl cap 20 mg , tab lorazepam 1 mg , tab risperidone 2 mg , tab acamprosate 333 mg , tab olanzapine 10 mg , tab sertraline 50mg , tab zolpidem 10 mg , formetrol 20mcg + budesonide 0.5mg respules , ipratropium bromide respirator soln 250 mcg/ml vial of 15ml , salbutamol sulphate respirator solution 5mg/ml , vial of 15 ml , titropium bromide 9mcg 120mtr dose inhaler , cough syrup each 5ml contains chlorpheniramine maleate ip 3mg , ammounium chloride ip 110mg , sodium citrate iop 46mg , menthol ip 0.9mg , syrup codeine phosphate 10 mg + chlorphenaramine maleate 4 mh per 5 ml bottle of 100 ml , syrup tabutaline sulphate 1.25 mg + bromphexine hcl 4 mg + guaphenesin 50 mg per 5 ml bottle of 100 ml , dextrose monohydrate for oral use pkt of 100gm

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39614656

10 Apr, 2025 1.66 Crore

Ponda - Goa

Tender For corrigendum : supply of patent veterinary medicine for year 2024-25 - inj. oxytetracycline hcl 200 mg/ml. (l.a.), inj. streptomycin sulphate i.p. 2.5 gmprocaine penicillin g.i.p. 15,lakhs units, penicillin g sodium i.p. 5,lakhs unitssterile water 20ml. 2.5 gms., inj. amoxicillin sodium i.p.3 gms.sulbactum i.p. 1.5gm., inj. sulphadiazine-400 mg trimethoprim 80 mg, amoxycillin sodium ip equivqlent to amoxycillin 200 mg sulbactam sodium usp equivalent to sulbactam 100 mg, inj. metronidazole 5mg/ml, bolus tetracycline hcl 500 mg., powder cephalexin 7.5% w/w, ointment for external use gamma benzene hexachloride 0.10% w/w proflavin hemisulphate 0.10%w/v cetrimide solution ip 0.45% w/v, intrauterine pesseries contains: trimethoprim 0.1 gm. sulpha methoxazole 0.5 gmurea 6 gm.(bolus), liquid uterine ofloxacin 50 mg ornidazole 125 mg urea 50 mg, liq. enrofloxacin 10% i.u., inj. phenylbutazone i.p 150 mg sodium salicylate, inj. dexamethasonesodium 4 mg/ml , adrenochrome 10 mg per ml, inj. iron dextran equivalent to elemental iron 50 mg/ml., inj. cyanocobalamin ip -150 mcgnicotinamide ip -100 mgcholine bitartrate usp- 10 mgd-penthenol ip -15 mgmyo-inositol bp -10 mgbiotin bp -10 mcgglycine ip- 20 mglysine hydrochloride bp- 20 mg, dl- methionine bp - 20 mgbenzyle alcohol ip -20 mg, oral liquid vit. b2 1.25 mgd panthenol 0.65vit b6 0.62 mgvit b126.25 mgnicotinamide37.5 mgcholine chloride 10 mglysine mono-hcl 10 mg per 5 ml, oral liquid ( consisting of liver fraction, yeast extract & nicotinic acid), oral bolus a unique blend of probiotics(saccharomyces cerevisiae, lactobacillus, spororgenes, aspergillus oryzae), minerals (organic zinc & copper, cobalt, chrominium), dl methonine & herbs(allium sativum, zingiber officinale,cichorium intybus, pimpinella, anisum, gentian root powder) carefully selected to give maximum benefit to optimize rumen function, and stimulate appetite and feed intake., permethrin 2 % sulphanilamide 5 % zinc oxide 2 %, inj. atropine sulphate 1mg./ml., inj. polyvalent anti snake venom lyophilized powder, inj. hydroxy progesterone caproate 250 mg/ml, dinoprost tromethamine, inj. xylazine hcl 23.32mg chlorocresol ip(as preservative 0.001%w/v), liquid - phosphorus- 235 g, calcium 103g, magnesium - 108g, sodium- 45.2g, magnanese- 10.8g, zinc- 10.2g, copper- 2.5 g, cobalt- 0.1g, intra mammary infusionprocaine penicillin 100000 i.u.i.p.streptomycin sulphate 100 mg b.p.sulphamezarine 500mghydrocortisone acetate 20 mg in 6 ml , inj. sodium bicarbonate, vitamin a, vitamin e, biotin (vitamin h), methionine, cystine, calcium, sulphur, copper, manganese, selenium, zinc, each 100 ml provides glutaraldehyde -10.0 ml,1,6 dihydroxy 2,5 dioxyhexane-10.3ml, polymethyl, derivatives-4.6 ml, each ml of isofluid contains : isoflupredone acetate i.p. 2mg, acetate ip benzyl 9 mg, alcohol ip (as preservative) water for injection qs to 1 ml, each ml contain:-inj. amoxicilin trihydrate 150mg. , each vial contain:cefquinome sulphate ( sterile) equivalent to anh.cefquinome500 mg. diluent ( each ml contains) sodium bicarbonate .160 mg, water for injection ip . q.s.

Central Government/Public Sector

CTN :39774693

12 Apr, 2025 NA

Kanchipuram - Tamil Nadu

Tender For supply of items for protein studies - ml040 to 500ml 5x tris sds buffer ph 500ml , ml039 to 500ml 2.5 x tris sds buffer ph 500ml , 10x tris glycine sds gel running buffer , acrylamide bisacrylamide solution 30 percent , prestainer protein ladder 10ln , bradford reagent 500ml , tris free base 500gm hhimedia , grm6365 to 500g di sodium hydrogen phosphate dihydrate , potassium dihydrogen , ml016 to 500ml 50 xtae used for gel electrophoresis , ml013 to 500ml to 1m tris cl ph 8 , ml123 to 1ktsilver staining kit , lysozyme 5gm , cms1889 to 1grifampicin 1gm , ammonium sulphate 500 gm , dodecyl sulphate sodium salt for mb 25gm , parafilm m 2 x 250 1pk roll , silver sulphate hi lr 25gm , albumin bovine fraction v 5gm , sd028-1vl penicillin g p 10units , storage vials pp 10ml sterile 300 pk pack tarson , glutaraldehyde solution 25 percent 25ml

CTN :39807687

09 Apr, 2025 NA

Anantnag - Jammu And Kashmir

Tender For e.nit no 03 gmca of 2025 for reagents, drugs and medical consumables - tender for reagents, drugs and disposables., inj. cefuroxime 1.5 g, inj.clindamycin 600 mg, inj.succinylcholine 50mg/ml, inj.vasopressin, inj.physostigmine, inj.anti rabies serum, inj.anti rabies vaccine, inj. piperacillin tazobactum 2.25 gm, inj.isoprenaline 2mg/ml, inj. dextrose normal saline 500 ml, inj. normal saline 500 ml, inj.iron sucrose, inj. tetanus toxoid, inj. diltiazem 5mg, inj.streptokinase, inj.tenectapilase, inj. vitamin k, inj. infusion haemaccel 500 ml, inj. teicoplanin, inj. methyl prednisolone 125 mg, inj. methyl prednisolone 500 mg, inj.xylocard 2%, inj. digoxin, inj.heparin 25000iu, inj.insulin 30/70, inj. haemaccel (3.5% colloidal infusion solution ) 500 ml, inj. biphasic insulin 30/70 40iu, inj.dextrose 5%, inj.paracetamol infusion 100 ml, inj.teicoplanin, iv fluid set, dispo syringe 5ml, dispo syringe 3 ml, dispo syringe insulin 31 g, angiocath 24 g/18 g, urine collection bag adult, glucometer strips along with meter, absorbant cotton 500 gm, gauze cloth than, sodium hypochlorite 5% and 10 %, av tubing blood lines, av fistula needles 16/17 g, citrosterile disinfectant 5 ltr can, diasafe plus filter, haemobicarb part a+part b, introducer needles, disposable pressure transducer, transducer protector, hollow fiber dialyzer, femoral catheter 14cm*14cm, ecg paper 210mm 20 mtr (ecg 9108 z-fold paper), antisera d 10 ml, widal kit, crp omega kit, aso kit, distilled water can 5 ltr, erba diluent h560, erba lyse -i h560, erba lyse -ii h560, glutaraldehyde solution(cidex) 5ltr, hiv elisa, dispo shoe cover, dispo blanket cover, dispo gown, ahg gel cards -matrix, abo gel cards -matrix, lyss -matrix 250ml, ahg coombs sera 5 ml, antisera abd 10 ml (tulip), anti sera ab 10 ml, anti sera a1 5 ml, pipette multi channel 10-100 micro litre, pipette multi channel 100-1000 micro litre, formalin liquid 5 ltr, hydrophilic foldable lens a/s, hydrophobic foldable lens a/s, rigid lens a/s, iris claw lens a/s, glass slides 75*25 mm 1*50, inj.erythropoitin 10000iu pfs, inj carboprostate tromethamine 250 mcg, inj etomidate, inj glycine 3000ml, inj valthamate bromide, macintosh apparan, mersilk (1) 5062, dispo molin sheets, monocryl (3-0), nasal oxygen set paediatric/ neonate/ adult, sr. blood urea (tulip/ranbaxy/meril/span), antisera-d 10ml (tulip), sr. albumin (tulip/ranbaxy/meril/span), sr. alkaline phosphate (tulip/ranbaxy/meril/span), sr. calcium (tulip/ranbaxy/meril/span), sr. creatinine (tulip/ranbaxy/meril/span), sr. phosphorous (tulip/ranbaxy/meril/span), sr. sgot (tulip/ranbaxy/meril/span), sr. sgpt (tulip/ranbaxy/meril/span), sr. total protein (tulip/ranbaxy/meril/span), stromatolyzer 500ml reagent for sysmex machine, cell pack 20 liter reagent for sysmex machine, tablet misoprostol 200mg, umbilical card clamp, usg paper type-v (sony), dynoprostone gel, iv set/ drip set, cautery pencil, ctg paper 151mm*90mm*150 sheets (bristal indian), phenyl black 5liter, cell clean 5ml sysmex, cell cleaner erba 5ml, qc erba high/low/normal, qc sysmex high/low/normal

corporations/Associations/Others

CTN :39816385

15 Apr, 2025 NA

Delhi - Delhi

Tender For supply of dental surgical consumables and chemicals - disposable needles 18 gauge 1 point 5 length , disposable needles 23 by 24 gauge 1 length , disposable needles 26 gauge 1 point 5 length , cotton bandage roll , bandage than absorbant gauge cloth , 5 percent w by v povidone iodine solution , 2 point 45 percent glutaraldehyde solution , absorbant cotton roll , disposable sterile sample culture bottle , desnet aldehyde and phenol free non corosive environment 1 lit , disposable non woven bedsheet blue , sterile disposable syringe with needle 10 ml syringe with 21 gauge , sterile disposable syringe with needle 2 ml syringe with 24 gauge 1 needle , sterile disposable syringe with needle 5 ml syringe with 24 gauge 1 needle , elastic zinc oxide self adhesive bandage , edta non vaccum blood collection tube 4ml , latex medical examination gloves powdered iso certified medium bar small , absorbent cotton gauze than , glucostrip-accu sure soul one box of 100 strips , glucostrip-codefree one box of 50 strips , non-woven disposable bouffant head cap with elastic band blue colour , non-woven disposable hiv pack for personal protection for hospital use sterile , hydrogen peroxide , inj diclofenac sodium ip , insulin syringe with fixed 30g bar 31g needle , local anaesthesia 2percentage lignocaine hydrochloride with adrenaline , microporous surgical adhesive tape , nitrile gloves for examination size medium powder free blue3 colour , normal saline sodium chloride inj ip , plain vacutainer non vaccum blood collection tube 4ml red colour , alcohol based hand sanitizer , chlorhexidin gluconate ip , disposable shoe cover non woven fabric blue colour elastic band for fit , silk suture 3 hypen 0 three bar 8 circle 16 mm 12pcs , silk suture 3 hypen 0 ns 5028 seam silk three bar 8 circle 26 mm 12 pcs , silk suture 4 hypern 0 one by two circle 16mm , silk suture 4 hypen 0 3 by 8 circle 16mm , silk suture 5 hypen 0 3by8 circle 16mm , 3 percent sodium hypochlorite for dental use , sodium hypochlorite 5 percent by 10percent , soframycin ointment 30g , 3ply surgical face mask , sterile surgical latex gloves 6.5 , sterile surgical latex gloves 7 , disposable non woven surgical gown , surgical spirit for hospital use , detachble bard parker surgical blade no 11 stailess steel , detachble bard parker surgical blade no 15 , toilet paper roll plai white 2ply , vaseline white softparaffin , polyglactin absorbable suture 3 point 0 90cm length , polyglactin absorbable suture 3 point 0 70 to 90 cm length , polygactin absorbable suture 4 poit 0 , lignocaine hydrochloride jelly , copper sulphate , coverslips 22mm 50mm point zero eight to point one three mm thickness , creatinine kit , crystal violete 125 ml , dextrose glucose , disposable high profile blade for microtome , disposable plastic tissue embedding ring , dpx mountant , ethanol , filter paper whatmen , formalin 5lt , fructose , glass slide 50psc , glass slides , god by pod sugar kit , gram iodine , hydrochloric acid , hydrochloric acid nby10 hcl , immersion oil , inoculating loop with holder , isopropyl alcohol , leishman stain , liquid ammonia , litmus paper blue , litmus paper red , maltose , may grunwald giemsa stain , methylene blue , molisch reagent , paraffin wax , protein estimation kit , saffranine , sodium carbonate , sodium nitroprusside , specimen jar with lid , sucrose , sulphur powder , sulphuric acid , test tubes 15 125mm , test tubes 15 150mm , uric acid kit , xylene , yellow tips

Furoseminde Tab Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector

corporations/Associations/Others