Get complete information related to latest Lauryl Tryptose Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Lauryl Tryptose Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Lauryl Tryptose Tenders.
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
Tender For bid to ras supply of paracetamol syp 125 mg 5 ml bottle of 60 ml , syrup calcium phosphate 80 mg 5 ml 200 ml bottle , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bott of 100 ml , chlorhexidine mouth gel hexigel , ibuprofenplusparacetamol syrup , clove oil bott of 50 ml , chlorhexidine mouth wash with 0dot12percent sugar alcohol free bottle of , glycerin glycerol 100 ml , calamine lotion , salicylic acid 3 5percent and coal tar 1 3percent soln bott , cetirizine syp 5mg 5ml bott of 60 ml , cypropheptadine hcl 2 mg 5ml bott of 100 ml , sucralfate suspension 1gm 10ml plusoxetacaine 10 mg 10ml bott of 200 ml , disodium hydrogen phosphate syrup , povidone iodine 10percent solution bott of 100 ml , iron syp paediatric each 5 ml containing elemental iron 25 50 mg and , metronidazole inj for iv use containing 500mg per bott of 100 ml , cough expectorant syp 5 ml containing diphenhydramine hcl 14dot08mg , cremaffine white each 15 ml containing milk of magnesia , grillintus dextromethorphan hbr 5 mg chlorpheniramine maleate2dot5 mg , povidone iodine 2percent gargle bott of 100 ml , multivitamin syrup bott of 200 ml , syp iron plus folic acid , levetiracetam 100 mg ml syr soln liquid bottle of 100 ml , sodium valproate oral solution 200 mg 5ml bott of 100 ml , albendazole syp each 5 ml containing 200 mg bott of 10 ml , antiseptic mouth wash containing sodium fluoride and triclosan bott of 100 ml , b complex with zinc syp , permethrin 5percent tube of 30 gm , lignocaine hcl jelly 2percent tube of 30 gm with sterile tube and short nozzl , cream silver sulphadiazine1percent tube of 25 gm , choline salicylate and benzalkonium chloride gel of 10 ml , desensitising paste stannous fluoride sodium monofluoro phopsphate , adapalene 0dot1percent tube of 15 gm , 0dot05percent halobetasol propionate plus 3percent salicylic acid ointment , 0dot05percent halobetasol propionate ointment , clindamycin phosphate 1percent topical gel tube of 10 gm , clobetasol propionate cream 0dot05percent in tube of 10 gm , clotrimazole cream 1percent tube of 15 gm , framycetin sulphate cream bp 1percent cream 20 gms , hydroquinone 2percent tube of 50 gm , terbinafine 1percent cream tube of 10 gm , tretinoin 0dot025percent tube of 15 gm , tretinoin 0dot05percent tube of 20 gm , conjugated estradiol 0dot625 mg per gm tube of 15 gm plus applicator , fluticasone propionate cream 0dot05percent tube of 10gm , diclofenac gel 1percent tube of 30 gm , clobetasole propionate 5percent plus gentamycin 5percent plus miconazole 2 percent tube of 20 gm , clotrimazole 2percent vaginal gel , combiflam ointment methyl salisylate 30percentplusmenthol10percen , hydroxypropyl methylcelluse eye gel genteal gel , luliconazole 1percent topical cream oint , methylsalicylateplusmentholpluscamphor cream , triamcinolone acetonide 0dot1percent tube of 5 gm , clobetasol and salicylic acid cream , clotrimazole vaginal pessary 100mg , povidone iodine 200 mcm pessary , fusidic acid cream 2 percent w w 10 g tube , nimesulide gel tube of 20 gm , povidone iodine skin oint , budesunide 1 mg respules , salmeterol 25 mcg plus fluticasone 250 mcg autohaler , salmetrol 25 mcg plus fluticasone 125mg mdi 120 doses , glycopyrronium and inhalation solution 25 mcg 5 respules of 2 ml each , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per , ipratropium bromide respirator soln 500 mcg 2 ml respule , tiotropium bromide 9 mcg 120 metered doses unit inh , tiotropium bromide 18 mcg and formoterol 12 mcg dry powder no rotacaps , formeterol 6 mcg and budesonide 400 mcg cfc free rotacaps , salmeterol 50 mcg plus fluticasone 250 mcg multi dose dry powder inh of 60 , formoterol 12mcg plus budesonide 400mcg inhaler , salmeterol 25mcgplusfluticasone propionate 50mcg inhaler seroflo 50 inhaler , budesonide 160 mcg formoterol fumarate dihydrate 4dot5 mcg symbicort , glycopyrronium 25mcg respules glycohale , ciclesonide 200mcgplusformoterol 6mcgplustiotropium 9mcg inhaler trimium , mesalazine 1gm sachet ,
Tender For tender for supply of benzoyl peroxide 2 point 5 percentage tube of 20 gm , fluconazole 150 mg cap oblique tab , octinoxate , avobenzone oxybenzone and zinc oxide lotion spf 15 or more 50 ml bottle , tacrolimus oint 0 point 03 percentage 20 gm tube , adapalene 0 point1percentage tube of 15 gm , clofazimine 100 mg cap , ivermectin tab 6mg , prednisolone 5 mg tab , clobetasol propionate cream 0 point 05 percentage in tube of 10 gm , framycetin sulphate cream bp 1 percentage cream 20 gms , salicyclic acid 3 to 5 percentage and coal tar 1 to3 percenatge soln bott , triamcinolone acetate 10 mg oblique ml inj , clarithromycin 1 percentage gel 15 gm tube , coal tar 6 percentage v oblique w plus salicylic acid 3percentage ointment 50 gm tube , extractum capae , heparin sodium , allantoin gel 20 gm tube , halobetasol propionate lotion 0 point 05 percentage w oblique v bottle of 30 ml , fusidic acid cream 2 percentage w oblique w 10g tube , cyclosporine a micro emulsion 100 mg oblique ml bottle of 50 ml , desonide 0 point 05percentage bott of 30 ml , terbinafine 1percentage cream tube of 10 gm , tretinoin 0 point 05 percentage tube of 20 gm , hydroxyzine hcl 25mgtab , tab valaciclovir hcl 500 mg , 13 point 9 percentage eflornithine cream 15g tube , fluocinolone acetonide 0 point 01percentage coma hydroquinone 2percentage plus tretinoin 0 point 025percentage tube of 20gm , acitretin 25mg cap , ointment salicylic acid 12percentage coma tube of 50gm , acetyl tetrapeptide 3 coma butylene glycol coma dextran coma inositol sera solution bottle of 60 ml , cream amorolfine 10gm , clobetasol propionate 0 point 05percentage and fusidic acid 20 gm , eberconazole nitrate 0 point1 percentage tube of 30 gms , fluocinolone acetonide in peanut oil base 50 ml 0 point 1percentage , ivermectin cream 1 percentage 30gm , melitane 5 percentage solution 60ml , minoxidil 2percentage lotion with methyl paraben 0 point2percentage , propyl paraben 0 point 02percentage and 40 percentage absolute alcohol with transcutol bottle of 60 ml , minoxidil 5percentage , finasteride 0 point1 percentage with capixyl topical solution 60ml , mometasone plus clotrimazole cream 10 gm , mometasone 3 point 5 percentage sa 20 gm , prp growth factor kit tube , ciclopirox olamine 8 percentage nail lacquer 5 ml , climbazole with piroctoneolamine 1 percentage 150 ml lotion , phenylethyl resorcinol coma aminoethylphosphinic acid cream 20 gm , acne uv sunscreen 60 gm 30 spf , mometasonefuroate lotion 0 point 1 percentage 10 ml , fluocinoloneacetoni0 shampoo 0 point 01percentage 100 ml , tab biotin 5 mg , 40 percentage urea cream gel 50 g , alpha lipoic acid 200 mg capsule , shuttle kojic acid with titanium dioxide cream 15 gm , 5 percentage amorolfine nail lacquer 2 point 5 ml , charcoal face mask 100 ml , fluticasone with mupirocin oint 10 gm , 4 to n butyl resorcinol with alpha arbutin serum 50 ml , rumex occidentalis extract plus morus alba leaf extract 45 gm , mandelic acid face wash 100ml , ophlopogon japonicas 250 ml lotion , piroctone olamine with climbazole shampoo 100 ml , itraconazole 200 mg cap , tab terbinafine 500 mg , methylene bis to benzotriazolyl tetramethyl butylphenol sunban matte gel tube of 75 gm , seabuckthon extract plus plus cowbwerry extract face wash tube of 100 ml , lotion methoxypsoralen , cap itraconazole 130 mg with super bio availability , lotion biotin plus hydrolyzed protein plus cystine plus trilast solution 60 ml , azithromycin gel 20gm , tab biotin 10 mg , cream maritech bright plus artonox plus cosmoperine novilite tube of 15gm , serum bakuchiol plus vitamin k plus retinol plus lumiage tremella plus pha , tab apremilast 20mg , lotion saw palmetto plus biotin plus dexpanthenol tricogro 100ml , lotion l arginine plus anagain plus saw palmetto plus foligain 100 ml , cream mometasone plus fusidic acid , cream desonide , glycolic acid 6 percentage coma macadamia oil 1 point 5percentage , ethyl ascorbic acid 1percentage coma tocopheryl acetate 1percentage com