Web Analytics Made Easy - StatCounter

Lauryl Tryptose Tenders

Get complete information related to latest Lauryl Tryptose Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Lauryl Tryptose Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Lauryl Tryptose Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39200933 Due date: 07 Apr, 202507 Apr, 2025 5.48 Lacs
Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39320124 Due date: 26 Mar, 202526 Mar, 2025 12.37 Lacs
Tender For bid to ras supply of paracetamol syp 125 mg 5 ml bottle of 60 ml , syrup calcium phosphate 80 mg 5 ml 200 ml bottle , bromhexine syp 5 ml containing 4 mg of bromhexine hcl bott of 100 ml , chlorhexidine mouth gel hexigel , ibuprofenplusparacetamol syrup , clove oil bott of 50 ml , chlorhexidine mouth wash with 0dot12percent sugar alcohol free bottle of , glycerin glycerol 100 ml , calamine lotion , salicylic acid 3 5percent and coal tar 1 3percent soln bott , cetirizine syp 5mg 5ml bott of 60 ml , cypropheptadine hcl 2 mg 5ml bott of 100 ml , sucralfate suspension 1gm 10ml plusoxetacaine 10 mg 10ml bott of 200 ml , disodium hydrogen phosphate syrup , povidone iodine 10percent solution bott of 100 ml , iron syp paediatric each 5 ml containing elemental iron 25 50 mg and , metronidazole inj for iv use containing 500mg per bott of 100 ml , cough expectorant syp 5 ml containing diphenhydramine hcl 14dot08mg , cremaffine white each 15 ml containing milk of magnesia , grillintus dextromethorphan hbr 5 mg chlorpheniramine maleate2dot5 mg , povidone iodine 2percent gargle bott of 100 ml , multivitamin syrup bott of 200 ml , syp iron plus folic acid , levetiracetam 100 mg ml syr soln liquid bottle of 100 ml , sodium valproate oral solution 200 mg 5ml bott of 100 ml , albendazole syp each 5 ml containing 200 mg bott of 10 ml , antiseptic mouth wash containing sodium fluoride and triclosan bott of 100 ml , b complex with zinc syp , permethrin 5percent tube of 30 gm , lignocaine hcl jelly 2percent tube of 30 gm with sterile tube and short nozzl , cream silver sulphadiazine1percent tube of 25 gm , choline salicylate and benzalkonium chloride gel of 10 ml , desensitising paste stannous fluoride sodium monofluoro phopsphate , adapalene 0dot1percent tube of 15 gm , 0dot05percent halobetasol propionate plus 3percent salicylic acid ointment , 0dot05percent halobetasol propionate ointment , clindamycin phosphate 1percent topical gel tube of 10 gm , clobetasol propionate cream 0dot05percent in tube of 10 gm , clotrimazole cream 1percent tube of 15 gm , framycetin sulphate cream bp 1percent cream 20 gms , hydroquinone 2percent tube of 50 gm , terbinafine 1percent cream tube of 10 gm , tretinoin 0dot025percent tube of 15 gm , tretinoin 0dot05percent tube of 20 gm , conjugated estradiol 0dot625 mg per gm tube of 15 gm plus applicator , fluticasone propionate cream 0dot05percent tube of 10gm , diclofenac gel 1percent tube of 30 gm , clobetasole propionate 5percent plus gentamycin 5percent plus miconazole 2 percent tube of 20 gm , clotrimazole 2percent vaginal gel , combiflam ointment methyl salisylate 30percentplusmenthol10percen , hydroxypropyl methylcelluse eye gel genteal gel , luliconazole 1percent topical cream oint , methylsalicylateplusmentholpluscamphor cream , triamcinolone acetonide 0dot1percent tube of 5 gm , clobetasol and salicylic acid cream , clotrimazole vaginal pessary 100mg , povidone iodine 200 mcm pessary , fusidic acid cream 2 percent w w 10 g tube , nimesulide gel tube of 20 gm , povidone iodine skin oint , budesunide 1 mg respules , salmeterol 25 mcg plus fluticasone 250 mcg autohaler , salmetrol 25 mcg plus fluticasone 125mg mdi 120 doses , glycopyrronium and inhalation solution 25 mcg 5 respules of 2 ml each , beclomethasone dipropionate 50 mcg and levosalbutamol 50 mcg per , ipratropium bromide respirator soln 500 mcg 2 ml respule , tiotropium bromide 9 mcg 120 metered doses unit inh , tiotropium bromide 18 mcg and formoterol 12 mcg dry powder no rotacaps , formeterol 6 mcg and budesonide 400 mcg cfc free rotacaps , salmeterol 50 mcg plus fluticasone 250 mcg multi dose dry powder inh of 60 , formoterol 12mcg plus budesonide 400mcg inhaler , salmeterol 25mcgplusfluticasone propionate 50mcg inhaler seroflo 50 inhaler , budesonide 160 mcg formoterol fumarate dihydrate 4dot5 mcg symbicort , glycopyrronium 25mcg respules glycohale , ciclesonide 200mcgplusformoterol 6mcgplustiotropium 9mcg inhaler trimium , mesalazine 1gm sachet ,

CTN :39796668 Due date: 25 Mar, 202525 Mar, 2025 NA
Tender For supply of sulfuric acid 98% (2.5 l) , sodium hydroxide (500 g) , acet ic acid glacial 100 % (500 ml) , ascorbic acid (100 g) , hydroge n peroxide (500 ml) , potassium dichromate (500 g) , diphenylamine for synthesis (100 g) , ortho-phosphoric acid 88% (500 ml) , ammonium iron (ii) sulfate hexahydrate (500 g) , charcoal act ivated (500 g) , boric acid powder (500 g) , pot assium permanganate (500 g) , perchloric acid about 70% (500 ml) , diethylenetriaminepentacet icacid (dtpa) (250 g) , ammonium acetate (500 g) , nitric acid about 69% (500 ml) , hydrochloric acid about 37% (500 m l) , ammonium fluoride purified (500 g) , triethanolamine (500 ml) , calcium chloride dihydrate (500 g) , potassium antimony (ii i) oxide tart rate hemihydrate (250 g) , methyl red indicator (25 g) , 2-4 dinitrophenol hyd razine 97 % , ammonium chloride (500 g) , salicylic acid (500 g) , disodium-edta (500 g) , azomethine-h (1 g) , kh,po. (potassium dihydrogen phosphate) (500 g) , nh. -oxalate (ammonium oxalate) (500 g) , nh.oh (ammonium hydroxide) (500 ml) , oxalic acid (500 g) , concentrated hf (hydrofluoric acid) (500 ml) , azocarmine (25 g) , ethyl alcohol (500 ml) , magnesium oxide (500 g) , k,so. (potassium sulphate) (500 g) , cuso. (copper sulphate) (500 g) , ammonium metavanadate (100 g) , 2,6-dichloro phenol indophenol (5 g) , sodium hydroxide (500 g) , ferrous ammonium sulphate (500 g) , sodium acetate (250 g) , tris acetate buffer (100 g) , potassium iodide (250 gm)

CTN :39668047 Due date: 03 Apr, 202503 Apr, 2025 NA
Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

CTN :39722102 Due date: 07 Apr, 202507 Apr, 2025 NA
Tender For tender for supply of benzoyl peroxide 2 point 5 percentage tube of 20 gm , fluconazole 150 mg cap oblique tab , octinoxate , avobenzone oxybenzone and zinc oxide lotion spf 15 or more 50 ml bottle , tacrolimus oint 0 point 03 percentage 20 gm tube , adapalene 0 point1percentage tube of 15 gm , clofazimine 100 mg cap , ivermectin tab 6mg , prednisolone 5 mg tab , clobetasol propionate cream 0 point 05 percentage in tube of 10 gm , framycetin sulphate cream bp 1 percentage cream 20 gms , salicyclic acid 3 to 5 percentage and coal tar 1 to3 percenatge soln bott , triamcinolone acetate 10 mg oblique ml inj , clarithromycin 1 percentage gel 15 gm tube , coal tar 6 percentage v oblique w plus salicylic acid 3percentage ointment 50 gm tube , extractum capae , heparin sodium , allantoin gel 20 gm tube , halobetasol propionate lotion 0 point 05 percentage w oblique v bottle of 30 ml , fusidic acid cream 2 percentage w oblique w 10g tube , cyclosporine a micro emulsion 100 mg oblique ml bottle of 50 ml , desonide 0 point 05percentage bott of 30 ml , terbinafine 1percentage cream tube of 10 gm , tretinoin 0 point 05 percentage tube of 20 gm , hydroxyzine hcl 25mgtab , tab valaciclovir hcl 500 mg , 13 point 9 percentage eflornithine cream 15g tube , fluocinolone acetonide 0 point 01percentage coma hydroquinone 2percentage plus tretinoin 0 point 025percentage tube of 20gm , acitretin 25mg cap , ointment salicylic acid 12percentage coma tube of 50gm , acetyl tetrapeptide 3 coma butylene glycol coma dextran coma inositol sera solution bottle of 60 ml , cream amorolfine 10gm , clobetasol propionate 0 point 05percentage and fusidic acid 20 gm , eberconazole nitrate 0 point1 percentage tube of 30 gms , fluocinolone acetonide in peanut oil base 50 ml 0 point 1percentage , ivermectin cream 1 percentage 30gm , melitane 5 percentage solution 60ml , minoxidil 2percentage lotion with methyl paraben 0 point2percentage , propyl paraben 0 point 02percentage and 40 percentage absolute alcohol with transcutol bottle of 60 ml , minoxidil 5percentage , finasteride 0 point1 percentage with capixyl topical solution 60ml , mometasone plus clotrimazole cream 10 gm , mometasone 3 point 5 percentage sa 20 gm , prp growth factor kit tube , ciclopirox olamine 8 percentage nail lacquer 5 ml , climbazole with piroctoneolamine 1 percentage 150 ml lotion , phenylethyl resorcinol coma aminoethylphosphinic acid cream 20 gm , acne uv sunscreen 60 gm 30 spf , mometasonefuroate lotion 0 point 1 percentage 10 ml , fluocinoloneacetoni0 shampoo 0 point 01percentage 100 ml , tab biotin 5 mg , 40 percentage urea cream gel 50 g , alpha lipoic acid 200 mg capsule , shuttle kojic acid with titanium dioxide cream 15 gm , 5 percentage amorolfine nail lacquer 2 point 5 ml , charcoal face mask 100 ml , fluticasone with mupirocin oint 10 gm , 4 to n butyl resorcinol with alpha arbutin serum 50 ml , rumex occidentalis extract plus morus alba leaf extract 45 gm , mandelic acid face wash 100ml , ophlopogon japonicas 250 ml lotion , piroctone olamine with climbazole shampoo 100 ml , itraconazole 200 mg cap , tab terbinafine 500 mg , methylene bis to benzotriazolyl tetramethyl butylphenol sunban matte gel tube of 75 gm , seabuckthon extract plus plus cowbwerry extract face wash tube of 100 ml , lotion methoxypsoralen , cap itraconazole 130 mg with super bio availability , lotion biotin plus hydrolyzed protein plus cystine plus trilast solution 60 ml , azithromycin gel 20gm , tab biotin 10 mg , cream maritech bright plus artonox plus cosmoperine novilite tube of 15gm , serum bakuchiol plus vitamin k plus retinol plus lumiage tremella plus pha , tab apremilast 20mg , lotion saw palmetto plus biotin plus dexpanthenol tricogro 100ml , lotion l arginine plus anagain plus saw palmetto plus foligain 100 ml , cream mometasone plus fusidic acid , cream desonide , glycolic acid 6 percentage coma macadamia oil 1 point 5percentage , ethyl ascorbic acid 1percentage coma tocopheryl acetate 1percentage com

CTN :39730912 Due date: 08 Apr, 202508 Apr, 2025 NA
Tender For supply of a 1 broth , azide dextrose broth , lauryl tryptose broth , nutrient broth , nutrient agar , peptone bacteriological , pfizer selective enterococcus agar , sterile cotton swab , durham tubes

Central Government And Public Sector

CTN :39540988 Due date: 03 Apr, 202503 Apr, 2025 21.5 Thousand
Tender For corrigendum : supply of chemicals to krims, karwar - ethyl alcohol 500ml for biochemistry (karwr), casien 500grm (karwr), sodium lauryl sulfate 500grm (karwr), methylmalonic acid 25grm (karwr), oxaloacetic acid 5grm (karwr), amido black 10b 100grm (karwr), p- dimethyl benzaldehyde 500grm (karwr), cholesterol 100grm (karwr), four-nitroaniline 250grm (karwr), demthyl amine 500ml (karwr), dimethyl sulphoxide 500ml (karwr), magnesium chloride 500grm (karwr), sodium salicylate 500grm (karwr), phosphotungustic acid 100grm (karwr), o-cresolphthlein complexone 5grm (karwr), succinic acid 500grm (karwr), eight-hydroxy quinoline 100grm (karwr), buffer capsule (karwr), brij (30 percent) 500ml (karwr), one-nitroso-2napthol 25grm (karwr), bromophenol blue 25grm (karwr), agarose medium 25grm (karwr), potassium dihydrogen orthophoshate 500grm (karwr), sodium chloride 500grm (karwr), di- acetyl monoxime 100grm (karwr), uric acid 100grm (karwr), creatinine 100grm (karwr), calcium chloride 500grm (karwr), lead oxide 500grm (karwr), cupric acetate 500grm (karwr), sulphur powder 500grm (karwr), conc .hydrochloric acid 5litrre (karwr), conc sulphuric acid 5litrre (karwr), conc.nitric acid 2.5litre (karwr), trichloro acetic acid 500grm (karwr), tris buffer 500grm (karwr), picric acid 500grm (karwr), thiosemicarbazide 500grm (karwr), tartaric acid 500grm (karwr), sulphosalycilic acid 500grm (karwr), starch 500grm (karwr), sodium dihydrogen orthophosphate 500grm (karwr), sodium pyuruvate 25grm (karwr), sucrose 500grm (karwr), sodium acetate 500grm (karwr), sodium tungustate dihydrate 100grm (karwr), resorcinol 500grm (karwr), phenyl phosphate disodium salt 25grm (karwr), potassium ferricynide 500grm (karwr), potassium sodium tartarate 500grm (karwr), potassium dichromate 500grm (karwr), phenyl hydrazine hydrochloride 500grm (karwr), pottasiun iodide 250gr (karwr), peptone 500grm (karwr), phenol crystals 500grm (karwr), oxalic acid 500grm (karwr), napthol 100grm (karwr), ninhydrine 100grm (karwr), methyl red solution 125ml (karwr), mercuric sulphate 250grm (karwr), molybdic acid 100grm (karwr), magnesium sulphate 500grm (karwr), maltose 500grm (karwr), metol 500grm (karwr), l-alanine 500grm (karwr), l-aspartic acid 100grm (karwr), leadacetate (anhydrous) 500grm (karwr), lactose 500grm (karwr), gelatin powder 500grm (karwr), ferric chloride anhydrous 500ml (karwr), formaldehyde 500ml (karwr), ethylene diamine tetraacetic acid 100grm (karwr), dipottasium oxalate 500grm (karwr), diphenyl amine 100grm (karwr), d- ribose 25grm (karwr), dexrose 500grm (karwr), dinitro phenyl hydrazine 500grm (karwr), d-fructose 500grm (karwr), calcium carbonate 500grm (karwr), coumasssie brilliant blue 25grm (karwr), chromatograph sheets 25units (karwr), chloroform 2.5litre (karwr), butanol 500ml (karwr), bromocresol green 100grm (karwr), barium chloride 500grm (karwr), amino acid kits (24nitem) 2box (karwr), iso-amyl alcohol 500ml (karwr), acetic anhydrous 500ml (karwr), alpha-keto glutaric 25grm (karwr), four-amino antipyrine 100grm (karwr), l-ascorbic acid 500grm (karwr), ammonium persulphate 500grm (karwr), one amino, 2-napthol,4-sulphonic acid 100grm (karwr), maglumi trop-i (karwr), maglumi ck-mb (karwr), fully automated analyser (xl) amylase 5x11ml (karwr), fully automated analyser (xl) d-dimer control( r1-5x1ml, r2- 5x1ml) (karwr), fully automated analyser (xl) ferritin control(1x1ml) (karwr), fully automated analyser (xl) crp control (1x1ml) (karwr), fully automated analyser (xl) ferritin with calibrator (r1- 2x14.5ml ), r2- 2x7.7ml (karwr), fully automated analyser (xl) d-dimer with calibrator( r2-1x4 ml) (karwr), sodium bisulphate 500gm (karwr), benzidine reagent 500ml (karwr), nitric acid 2.5l (karwr), acetone 2.5 l (karwr), sodium sulphite 500gm (karwr), sodium hypobromite 500ml (karwr), silver nitrate 500gm (karwr), sodium bisulphite 500gm (karwr), sodium hydroxide pellets 5 kg (karwr), sodium carbonate 500gm (karwr), glacial acitic acid 500ml (karwr), iodine 1

CTN :39567888 Due date: 26 Mar, 202526 Mar, 2025 NA
Tender For supply of items and equipment for botany, zoology,physics, chemistry and geography laboratory - name of equipment -geography lab, plain table set, prismatic compass, weather maps set, chain tape set, compass 100mm, levelling staff 4meter, illuminating, globe 3 dimensional physical, illuminating, globe 3 dimensional political, photo of great geographers, relief maps of india, topo sheets ( survey of india), set of 25 non-metallic minerals for industrial use, ranging rod, almirah (full size), name of equipment -zoology lab, digital single pan balance 300gm, digital ph meter, digital thermometer, haemocytometer(complete box), sphygmomanometer, compound microscope, water distillation apparatus 4lit. s.s., electrophoresis submarine with power supply, centrifuge machine doctor model 8tubes, haemoglobinometer, spectrophotometer, almerah, slides, coverslip, cavity slide, test-tube, beaker ( 50 ml ,100 ml,250 ml ), watch glass 3 , conical flask (100 ml , 250 ml), tissue paper, filter paper, models, specimens, permanent slides, (d human skleton model, name of equipment -chemistry lab, beaker ( 50 ml , 100 ml , 250 ml), burette 50ml, conical flask ( 50 ml , 100 ml , 250 ml, pipette ( 10 ml , 25 ml ), volumetric flask (100ml , 250 ml , 500 ml ), watch glass 3 , spatula, glass rod, measuring cylinder (50 ml , 100 ml ), funnel 75mm, test-tubes, tripod stand, burette stand, glass slides pkt, bunsen burner, desiccator, ignition tube, glass bottles 250ml, sprayer, filter paper, whatmann filter paper no.1, chromatographic jar, tlc kit, corks, test-tube stands, vaccum pump, distillation unit s.s. 4lit., reflux unit, round bottom flak 250ml, digital chemical balance, thermometer, colorimeter, ph-meter, theles-tube, water bath /sand bath, almirah, sodium chloride 500gm, anti a, b,d (3x10ml), methanol 500ml, acetocarmin 100ml, xylol (xylene) 500ml, canada balsam 100ml, eosin 125ml, glycerine 500ml, potassium hydroxide 500gm, sodium hydroxide 500gm, chloroform ( 500 ml ), d p x mountant 250ml, distill water 5lit., acetone 500ml, acetic acid 500ml, ammonium chloride 500gm, sodium sulphate 500gm, acetanillide (500gm), ammonium acetate 500gm, ammonium ferrous sulphate (500gm), ammonium carbonate(500gm), benzoic acid 500gm, copper sulphate (500gm), conc. hydrochloric acid 500ml, conc. sulphuric acid 500ml, calcium chloride (500gm), chloroform ( 500 ml ), ethyl alcohol ( 500 ml ), ethyl acetate ( 500 ml ), ferric chloride (500gm), fehling solution a 500ml, fehling solution b 500ml, glacial acetic acid ( 500 ml ), glycerine ( 500 ml ), ferrous sulphate (500gm), iodine (100gm ), nepthalene (500gm), nitric acid ( 500 ml ), alpha naphthol (100gm), beta nephthol (250gm), oxalic acid (500gm), phenyl hydrazine 250ml, potassium dichromate (500gm), potassium permanganate(500gm), phenophthalein 125ml, phthalic acid 500gm, phenol 500gm, resorcinol 250gm, sodium metal 100gm, sodium carbonate (500gm), sodium nitrite (500gm), salicylic acid (500gm), starch 500gm, sucrose (500gm), silica gel g for tlc 500gm, zinc dust 500gm, buffer tablets ( 4,9,7 ) 10tab. each pack, benedict solution 500ml, molisch reagent 125ml, silver chloride 25gm, lead acetate (500gm), methylene blue 125ml, nesslers reagent 100ml, methyl orange 125ml, urea crystal (500gm), calcium carbonate (500gm), edta solution 500ml, pot. chloride (500gm), diethyl ether (500 ml ), dimethyl glyoxime (100gm), ammonium hydroxide (500ml), ferric sulphate (500gm), magnesium chloride (500gm), zinc chloride (500gm), silver nitrate (25gm), barium chloride (500gm), manganese sulphate (500gm), aluminum sulphate (500gm), pot. nitrate (500gm), sodium acetate (500gm), aluminium foil, formaline 500ml, acetone( 500 ml ), safranine sol. 125ml, haematoxylin 125ml, crystal violet-used to stain bacteria 125ml, name of equipment -botony lab, petri dish 3 , watch glass 3 , wash bottles plastic 500 ml, wash bottles plastic 250ml, cover silp 22mm blue star, plain slides, flasks ( 100 ml , 50 ml , 200 ml ), beaker ( 50 ml ,100 ml,200

State Government

CTN :39651897 Due date: 01 Apr, 202501 Apr, 2025 8.00 Lacs
Tender For supply of chemical - butan 2 one butanone ethyl methyl ketone 500ml , 1 bromobutane 500g , 4 bromobenzaldehyde 250g , acetic acid glacial 25ltr , acetone 25ltr , acetone uv hplc 500ml , acetonitrile 500ml , acetophenone 500ml , acetyl acetone 500ml , acetyl chloride 500ml , alpha naphthol 1 naphthol 100g , ammo ferrous sulphate ar , aluminium ammonium sulphate 500 g , aluminium chloride 500g , ammonia liquor 500ml , ammonium acetate 500g , ammonium chloride 500g , ammonium nitrate 500g , ammonium thiocyanate 500g , aspirin 250g , s benzyle thiuanium chloride 500g , benzaldehyde 500ml , benzamide 500g , benzil 250g , benzoic acid 500g , benzoyl chloride 500ml , benzyl tri phenyl phosphonium chloride 500g , bismuth nitrate 100g , boric acid 500g , bromine 20x5ml , bromobenzene 250ml , butyl alcohol 25ltr , carbon tetra chloride 500ml , cetyl alcohol 500g , chlorobenzene mono chlorobenzene 500ml , chloroform 500ml , cobalt chloride 100g , cobalt chloride hexahydrate 100g , copper acetate monohydrate 250g , copper sulphate cuso45h2o ar , cyclohexanone 500ml , d fructose 100g , di ammonium hydrogenphosphate , di butyl phthalate 500g , di sodium tetraborate borax 500g , dl tryptopan 10g , ethyl aceto acetate 500ml , glycerine glycerol , hexane 500ml , hydrochloric acid gr 500ml , hcl , iodine 100g , iron sulphide 1kg , lead carbonate 500g , magnesium stearate 500g , magnesium trisilicate 500g , maleic anydride 500g , manganese ii sulphate 500g , methanol 500ml , methyl acetate 500ml , mineral oil , n butanol 25ltr , n butyl acetate 500ml , nitric acid ar 500ml , nitric acid lr 35kg chaudhey chemicals , n methyl aniline 500ml , orthophosphoric acid 25ltr , oxalic acid ar 500g , parabens 500g , phenyl hydrazine hydrochloride 100g , phthalic acid 500g , pigment 500g , polyphosphoric acid 500g , potassium bromate 500g , potassium dichromate 500g ar , potassium iodide , potassium oxalate 500g , potassium phosphate tribasic 500g , potassium sodium tartrate 500g , rhodamine d 100g , semicarbozide hydrochloride 100g , sodium acetate anhydrate 500g , sodium acetate anhydrous 500g , sodium bicarbonate 500g ar , sodium hydroxide pelletes 500g , sodium oxalate 500g ar , sodium sulphite 500g , stearic acid coloring agent 500g , succinic acid 500g , sucrose 500g , sulphuric acid lr 4 5kg chaudhry chemicals , t butanol 500ml , t butyl cyclohexanone 500ml , tlc silica gel aluminium plates , toluene 2 5ltr , tri sodium citrate 500g , tryptophan 25g , urea 500g , beaker 100ml , beakers 250 ml , beakers 400 ml , bodmel flask melting point appertus , boiling tube , brush semi miceo kit , brush bottle 18 , burette clamp boss head , burette clamp fish type , capiller tube pkt , conical flask 150 ml , conical flask 250 ml , dropper 6 glass , dropper 3ml plastic 500pcs , dropper 1ml plastic 500pcs , filter paper whatman no curculer , filter paper crometography , filter paper ordnery extra obgerb500 sheet rim , funnel 2 , labolin 5ltr , measuring cylender 10 ml borosil glass , measuring cylender 25 ml borisil glass , rubber tube 5mm , rubber tube 6mm , rubber tube 7mm , rubber tube 8mm , rubber tube 9 mm , spatula steel 6 , test tubes 15 125 mm 100pcs , viscometer borosil glass , volumetric flask 100 ml , water bath alluminium , wire gauze bid details/ 2 / 103
 Loading, Please wait...

Connect us via What's Up