Web Analytics Made Easy - StatCounter

Lead Monoxide Tenders

Get complete information related to latest Lead Monoxide Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Lead Monoxide Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Lead Monoxide Tenders .

Filter
Loading....
Loading....
Loading....
Loading....
Loading....

Bid Submission Date Range
Tender Value

Central Government/Public Sector

CTN :39237460 Due date: 31 Mar, 202531 Mar, 2025 NA
Tender For bid to ras corrigendum : supply of sodium cyanide

Central Government/Public Sector

CTN :39835162 Due date: 16 Apr, 202516 Apr, 2025 NA
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39814395 Due date: 15 Apr, 202515 Apr, 2025 NA
Tender For supply of sodium cyanide

CTN :39597184 Due date: 27 Mar, 202527 Mar, 2025 NA
Tender For supply of sodium cyanide tech. grade is: 6358-1971 , sodium dichromate to specn. is: 249-1972

Central Government/Public Sector

CTN :39555427 Due date: 25 Mar, 202525 Mar, 2025 NA
Tender For supply of science and geography lab equipments - beaker (500 ml) , conical flask (250ml) , bleaching powder , hydrogen peroxide , ph paper , ferrous sulphate , phenolphthalein indicator , potassium nitrate , capillary tube , digital weighing machine , centrifugation apparatus , distilled water making apparatus , chromatography paper , thiourea , measuring flask (250 ml) , potassium iodide , ethanol , methanol , potassium permangnate , lead nitrate , ferric ferro cyanide , dimethyl glyoxime , pipette (20 ml) , ammonium sulphide , bottle opener , centrifugation tube , paper slip for chemical name, digital microscope , gel electrophoresis machine , micropipettes (10microlitre) , eppendorf tubes , acrylamide gel , calcium nitrate , conical flasks 250 ml , wash bottles , petridish , blotting paper , chromatographic paper , spirit lamp , test tube stand , ethanol , wire guage , ether acetone solvent , acetone , capillary tube , mortar and pestle , measuring cylinder(50ml) , measuring cylinder(100ml) , potassium hydroxide pellets , mini test tubes , u-shaped bend glass tube , cavity slides , lime water , microscope lens cleaner , charts dna replication, transcription, translation, cymose and racemose inflorescence , models-symbiotic association in root nodules of leguminous plants, cuscuta on host , glass rod , permanent slides-monocot, dicot leaf, labeo rohita, catla(fish), v.s of blastula, malarial parasite(plasmodium) , human brain model(4d) , beaker 100ml , funnel, vernier calliper , manual , vernier calliper digital , screw gauge manual , screw gauge digital , meter scale , half meter scale , pn junction apparatus , connecting wires , travelling microscope , gravestand apparatus , laser light , hooks law apparatus , projectile launcher , slinky , electric tool kit , compass , rheostat , ohms law apparatus, number planet ml 112 , geo geometric stick ml 123 , vertex wonder ml 124 , trigonometry board ml 216 , cylinder cut in 8 parts wooden ml 227 , playing cards ml 234 , dice superior set of 6 ml 235 , arithmetic progression ml 304 , probability kit ml 303 , fraction, decimals & percentage chart um 101 , sextant models mks , , conic section with standard equations ml 301 , set theory by venn diagram ml 302, metal slinky , optical stand , concave lens/mirror , concave lens/mirror , plane mirror , laser lights , glass prism 50x50mm , 9v battery , separating funnel500ml borosil , lab thermometer , testtube rack , testube holders , droppers , lodine solution , copper sulphate , sodium hydroxide , pallets , ethanol , lime water , gycerine , potassium nitrate , hydrogen peroxide 6% , conical flask (1000ml) , spatula , whatman filter paper , copper wire , tripod stand 10"

CTN :39530511 Due date: 02 Apr, 202502 Apr, 2025 NA
Tender For supply of various chemicals and fine chemicals, at skims, soura, srinagar on one year rate contract basis. - item specifications, 2-mercaptoethanol, absolute alcohol 99%, acetic acid, acetic acid glacial, acetone, acid fuchsin, acrylamide, alpha naphthol, alpha naphthylamine, ammonium acetate, ammonium chloride, ammonium persulphate, amyl alcohol, basic fuchsin, bis-acrylamide, bismark brown (powder), boric acid, bromophenol blue, calcium chloride, calcofluor white, carbol fuchsin (zn, strong), chloroform, conc. hydrochloric acid (hcl), conductive electrode paste/eeg paste, copper sulphate, crystal violet, diethyl pyrocarbonate (depc), dimethyl formamide, dimethyl sulfoxide (dmso), dimethyl-p-phenylene diamine dihydrogen chloride, dipotassium hydrogen phosphate, disodium edta, disodium hydrogen phosphate, dpc, dpx, edta dipotassium salt, eosin liquid, eosin powder, eosin y, ethanol 99%, ethedium bromide (etbr), ethyl alcohol, formaldehyde 37%, formic acid 85%, fungizone, giemsa stain, glycerol glycerin 98%, haematoxylin harris, hematoxylin (liquid), hematoxylin (powder), hydrochloric acid (98%), hydrogen peroxide (30%), hypochlorite solution (4%), iodine, isoamyl alcohol, isopropyl alcohol 99%, l pyrrolidonyl-b-naphthylamide, laboratory detergent, leishman s stain, liquid ammonia, lithium powder, magnesium chloride, magnesium citrate, magnesium sulphate, may grunwald stain (powder), mercuric oxide powder, methanol 99%, methyl red (powdered), methylated spirit, methylene blue (powdered), medical grade soda lime with following specifications: 1. should have high absorption capacity for carbon dioxide (more than 100 ltr/kg)2. should have low dust level.3. granule size 2.5-5.0 mm4. indicator pink to white., n acetyl l cysteine, n,n, dimethyl formamide, nigrosin, nitric acid 72%, para dimethyl amino benzaldehyde, para-dimethyl amino cinnamaldehyde, parafin oil (liquid), periodic acid, phenol, phenol (tris saturated), phosphate buffer saline capsules/tablets, potassium acetate, potassium bicarbonate, potassium chloride, potassium dichromate, potassium dihydrogen orthophosphllate, potassium dihydrogen phosphate na2hpo4, potassium ferro cyanide k4fe(cn), potassium hydroxide, potassium iodide, potassium permanganate, silver nitrate, skin preparation gel, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium deoxycholate, sodium dihydrogen orthophosphate, sodium dihydrogen phosphate, sodium dodecyl sulphate (sds), sodium hippurate, sodium hydroxide, sodium hypochlorite, sodium taurocholate, sucrose, sulfanilic acid, sulphuric acid, tetramethyl-p-phenylene diamine dihydrogen chloride, toluidine blue (powder), tris, tris hcl, urea (nh3conh2), xylene 98%
 Loading, Please wait...

Connect us via What's Up