Latest liquid ammonia solution Tenders | Government liquid ammonia solution Tenders

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39835249

16 Apr, 2025 25.73 Lacs

North 24 Paragana - West Bengal

Tender For procurement of generic medicines - cream.permathrin 5 percent 30gm , drop.ciprofloxacin 0.3 percent eye 5ml , drop.xylometazoline 0.1 percent nasal decongestant adult 10ml , inj.dexamethasone 4mg per ml 2ml , inj.diazepam 10mg per 2ml , inj.dicyclomine 10mg per ml 2ml , inj.metoclopramide 5mg per ml 2ml , inj.ondansetron 2mg per ml 2ml , inj.pantoprazole 40mg , inj.pheniramine maleate 22.75mg , lignocaine hcl gelly 2 percent 30gm , lotion.povidone iodine 10 percent 500ml , mdi levosalbutamol 50mcg per dose , sterile water for injection 10ml , syr.albendazole 10ml , amoxycillin 200mg clavulanic acid 28.5mg and lactic acid bacillus 60 million spore dry syrup , syr.cefixime 50mg per 5ml bott of 30ml , tab.clobazam 5mg , tab.clopidogrel75mg , tab.enalapril 5mg , tab.escitalopram 10mg , tab.folic acid 5mg , tab.isosorbide 5 mononitrate 20mg , tab.levothyroxin 25mcg , tab.levothyroxine 100mcg , tab.levothyroxine 50mcg , tab.metformine 500mg sr , tab.metformin sr 1gm , tab.metoprolol 50 mg xl , tab.ondansetron 8mg , tab.prednisolone 5mg , tab.ramipril 5mg , tab.telmisartan 40mg , tab.telmisartan40 plus hydrochlorthz 12.5 mg , cap.tamsulosin 0.4mg , cap.vitamin e 400mg , ferrous ascorbate 100mg and folic acid 1.5mg tablets , clotrimazole1 percent powder 100gm , cream.silver sulphadiazine1 percent weight per weight 20gm , drop.ciprofloxacine plus dexamethasone 10 ml , drop.multivitamin bottle of 15ml , drop.sodium chloride nasal , inj.amikacin 250mg , inj.etophyllin 84.7mg plus theophylline 25.3mg per ml , inj.hydrocortisone sodium succ.100mg , inj.lignacaine 2 percent , inj.lignacaine 2 percent plus adrenalline , inj.tranexamic acid 500mg per 5ml , mdi ipratropium bromide plus levosalbutamol , oint.betamethasone 0.05 percent plus salicilic acid 3 percent 25gm , oint.mometasone 0.1 percent 10gm , oint.mupirocin 2 percent 5gm tube , heparin sodium 50iu and benzyl nicotinate 2mg ointment 20gm , levo-salbutamol 1.25mcg plus ipratropium 500mcg respules 2.5 ml , ambroxol hydrochloride 15 mg guaifenesin 50 mg and levosalbutamol sulphate 1 mg syrup , phenylephrine 5 mg chlorpheniramine 2 mg and dextromethorphan 10 mg syp , tab.aciclovir 800mg , tab.alprazolam 0.25mg , tab.aspirin enteric coated 150mg , tab.aspirin enteric coated 75mg , tab.betahistine hcl16mg , tab.cinnarizine 25mg , tab.etophylline-115 plus theophylline-35mg in slow release , tab.febuxostate 40mg , tab.fenofibrate 200mg , tab.finasteride 5mg , tab.glucosamin 500mg , tab.nor-ethisteron 5mg , tab.torsemide 10g , tab.voglibose 0.2mg , tab.voglibose 0.3mg , tab per cap.pregabolin 75mg , tab per cap.vitamin b complex b1 b6 b12 , antiseptic mouth wash chlorhexidineip 0.2 percent weight per volume 100ml , vit. d3 sachet cholecalciferol 60k , tab.teneligliptin 20mg , clotrimazole mouth paint 1 percent weight per volume 25ml , syp.ondansetron 2mg per 5ml 30ml , tab.montelukast10 plus levocetrizine , glyceryl trinitrate cr 2.6mg , mouth ulcer gel choline salicylate sodium 9 percent weight per volume benzalkonium chloride 0.01 percent weight per weight 10gm , drotaverine hcl tablets 40mg , atropine sulphate injection ip 0.6mg per ml 1ml , gabapentin capsules ip 300mg , carvedilol tablets ip 3.125 mg , tabsosorbide dinitrate ip 10mg , dopamine hydrochloride injection ip 200 mg per 5ml , streptokinase inj. ip 15 00 000 iu 10ml , carboxymethlycellulose eye drop 1 percent weight per volume 10ml , tranexamic acid tablets ip 500 mg , propranolol tablets ip 40 mg , lactulose solution 10g per 15ml 100ml , tab pregabalin sr75mg plus methylcobalamin 750mcg , sitagliptin phosphate tab. ip 100mg , dapagliflozin tablets 10 mg , inj.enoxaparin ip 40 mg per 0.4 ml , inj. enoxaparinip 60 mg per 0.6 ml , adenosine injection 3mg per ml 2 ml , phenytoin tablets ip 100 mg , metoprolol succinate pr 25mg tablets ip 25mg , rabeprazole gastro resistant tablets ip 20 mg , esomeprazole tablets ip 40mg , miconazole nitrate cream ip 2 percent , luliconazole cream ip 1 percent weight per weight 10gm , inj.tramadol

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

CTN :39847016

17 Apr, 2025 NA

Sagar - Madhya Pradesh

Tender For supply of l lysine 20mg zinc 25mg dimethionine 40mg calcium pantothenate 50mg niacinamide50mg tab , bisacodyl 5 mg tab , bisoprolol 2 point 5mg tab , bisoprolol 5mg tab , brimonidine 0 point2 percent w byv eye drops , brivaracetam 100mg tab , bromhexine 100 ml syp , bupropion 150 mg tab , cabergoline 0percent5 mg tab , calamine lotion 100 ml , calcium and vit d3 syp 200ml bott , calcium carbonate and calcitirol and methulcobalamin and vitamin k2 and zinc tab , calcium citrate malate and vitamin d3 tab , canagliflozin 100 mg tab , mouth paint clotrimazole , carbamazepine 200 mg cr tab , carbidopa 10 mg and levodopa 100 mg cr tab , carbidopa 18 percent 75 and levodopa 75 mg and entacapone 200 mg tab , carbidopa 25 and levodopa 250 mg tab syndopa 275 mg , carbidopa 25 mg and levodopa 100 mg cr tab , carbimazole 5mg tab , carvedilol 12 percent5 mg tab , carvedilol 6 percent25 mg tab , cefixime 200 mg tab , cefixime 200mg and clavulanate 125 mg tab , cervical collar size l , cervical collar size m , cervical collar xl , cetrizine 5mg and paracetamol 325mg andphenylephrine hcl 5mg , chest binder all size , chlordiazepoxide 10 mg tab , chlordiazepoxide 5 mgand clidinium bromide 2 percent5 mg , chlorhexidine mouth wash 2 percent bott of 100 ml , chlorhexidine mouthwash 2 percent bottle of 150 ml , chlorthalidone 12 percent 5 mg tab , chlorthalidone 6 percent25 mg tab , choline salicylate 8 percent andlidocaine 2dologel , cilnidipine 10 mg tab , cilnidipine 5 mg tab , cilostazol 100 mg tab , cinitapride 3mg pantoprazole 40mg tab , cinnarizine 25mg tab , ciprofloxacin 500mg tab , clarithromycin 1 percent gel 15gm , clavicle support medium size , clindamycin 1 percentgel 10 gm , clindamycin 300 mg cap , clobazam 10mg tab , clobazam 5 mg tab , clobetasol miconozole gentamycin oint , clofazimine 100 mg cap , clonazepam 0 percent5 mg tab , clotrimazole 1 percent w by v ip and and lignocaine 2 percent w byv ip ear drop bott of 10ml , clotrimazole 100mg vaginal tablets , clotrimazole cream 1 percent tube of 15 gm , coenzyme q10 100 mg tab , colchicine 0 percent 5 mg tab , collagen peptide and hyaluronate tab , collagen peptide 40mg and sod hyluru 30mgand chondrotin tab , coloplast lubricating deodrant , coloplast paste 2650 , coloplast plate , colostomy bag 60 mm , colostomy bag with flange and clamp size 50and 57 mm with deodorant charcoal chamber , colostomy bag with flange and clamp size 60 and 67 mm with deodorant charcoal chamber , colostomy bag with flenge 50mm , colostomy bag with flenge 60mm , colostomy belt , corn cap , cotton 50 gm pkt , cotton absorbent 500 gm , cotton non absorbent 500 gm , cyclosporin 50 mg tab , cyproheptadine 4 mg tab , cyproterone 2mg ethinyl estradiol 0point0 35mg ginnete 35tab , dabigatran 110 mg tab , dapagliflozin 5 and linagliptin 10 mg tab , denosumab 120 mg by ml inj , dental gel , desensitising paste stannous fluoride potassium nitrate sod monofluorophosphate tube of 50gm , desvenlafaxine 100 mg tab , diclofenac 50 mg and paracetamol 325 mg tab , dicyclomine 10mg bid details/ 2 / 141 and mefenamic acid 250mg tab , digoxin 0 point 25 mg tab , diltiazem 60 mg tab , divalproex sodium cr 500 mg tab , domperidone 10 mg tab , donepezil 10 mg tab , donepezil 5 mg tab , dorzolamide 2 per w by v and timolol 0 point 5 percentw by v eye drop , dosulepin 25 mg dothiepin tab , dosulepindothiepin prothiadren 50 mg tab , doxepin 75 mg cap , duloxetine 20mg cap , duloxetine 30 mg tab , dutasteride 0.5 mg tab , dvt stocking medium , dvt stocking small , dvt stocking xl , dydrogesterone 10 mg duphaston tab , ear drop chloramphenicol 5percent w by v clotrimazole 1percent wby v betamethasone 0 point 25percent w by v lignocaine hcl 2percent w by v in bottle of 5 ml , ecg electrodes , ecg gel , ecg roll , eye drop 0point 2 per olopatadine hydrochloride with povidone iodine and drop tainer systme , ed carboxy methyl cellulose 0 point5 percent bott of 5ml , ed ciprofloxacin and dexamethasone , ed ciprofloxacin 0point 3 percen

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39817354

23 Apr, 2025 87.71 Lacs

Belagavi - Karnataka

Tender For supply of lot-7 items to belagavi zone prisons - cpb-bottom wheel all size, cpb-drawer lock all size, cpb-sliding glass wheel all size , cpb-aluminium double channel all size , cpb-drawer handle all size, cpb-yellow amber, cpb-aluminium tower bolt all size, cpb-abro tape , cpb-plastic can wire, cpb-planning blade , cpb-mobile oil., cpb-emery/sand paper , cpb-sand paper , cpb-leminated sheet, cpb-laminated sheet , cpb-wood polish, cpb-adasive for corpentry, cpb-pencil, cpb-bee-wax, cpb-ost plywood, cpb-plywood sheet-6 mm, cpb-plywood sheet-19 mm, cpb-cr plywood, cpb-primmer wood or metal, cpb-hinges all size, cpb-wire nails all size, cpb-n.c. thinner, , cpb-terpent oil , cpb-painting brush , cpb-measuring tape , cpb-key plates ms all size, cpb-hinges , cpb-hacksaw blades different size, cpb-grinding wheel / stone , cpb-emery paper-water proof , cpb-drill bit different sizes , cpb-cutting machine spare parts, cpb-cutter blade (hand), cpb-cot bush , cpb-bush different size for cot and chairs, cpb-robin blue, cpb-tin opal, cpb-washing soda.., cpb-charcoal, cpb-male female socket , cpb-iron box socket , cpb-landry iron box coil , cpb-direct dyes colour, cpb-napthol colour, cpb-chloro phenyl, cpb-deel wood box, cpb-raw colour, cpb-hydrosulphate of soda, cpb-hydro chloric acid., cpb-washing soda., cpb-rosin , cpb-sodium silicate, cpb-phenyl colour, cpb-1 litre plastic bottle, cpb-carbolic acid, cpb-soap colour, cpb-stone salt, cpb-rosin paste, cpb-pine oil, cpb-perfume phenyl scent, cpb-perfume soap, cpb-neem oil, cpb-maha karanja oil, cpb-fire wood., cpb-creosote oil , cpb-caustic soda., cpb-coconut oil., cpb-castor oil, cpb-elastic , cpb-white thread tube, cpb-marking chalk, cpb-machine needles , cpb-pant hooks, cpb-machine oil, cpb-pocket cloth , cpb-over lock thread , cpb-khaki button, cpb-hand needles, cpb-pressing button, cpb-pant patti canvas, cpb-pressing canvas, cpb-khaki zips , cpb-khaki thread tube , cpb-cutting scissors steel 10inch 12inch, cpb-white button, cpb-thread tube (all shades) , cpb-measuring tape, cpb-colour thread (different shades) , cpb-bobbin case, cpb-bobbin tailiring, cpb-blouse hooks , cpb-fire wood, cpb-shuttle pegs, cpb-direct dyes, cpb-washing soda, cpb-vat colour, cpb-turkey red oil, cpb-tino pal, cpb-sodium nitrate, cpb-shuttle tongue (pin), cpb-salt., cpb-naphthol colour, cpb-mobile oil, cpb-loom spring , cpb-leather belt loom , cpb-caustic soda, cpb-hydro sulphate of soda, cpb-hydro chloric acid, cpb-h.s. woollen yarn, cpb-greece, cpb-different colours dyed yarn-20s, cpb-different colours dyed yarn-6s, cpb-different colours dyed yarn-10s, cpb-different colours dyed yarn-2/10s, cpb-different colours dyed yarn-2/20s, cpb-g.c. yarn-6s, cpb-g.c. yarn-20s, cpb-g.c. yarn-2/40s, cpb-g.c. yarn-2/20s, cpb-g.c. yarn-2/10s, cpb-g.c. yarn-10s, cpb-g.c. yarn-3/6s

Central Government/Public Sector

CTN :39562406

27 Mar, 2025 5.34 Crore

Paradip - Odisha

Tender For corrigendum : supply of "albendazole 200mg, 10 ml. bottle " , di-sodium hydrogen citrate 1.37g/5ml. pack of 100ml. , amoxicillin 200 mg,clavulanic acid-28.5 mg/5ml.bottle of 30ml , sucralfate1gm,oxetacaine 20mg/10ml. bottles of 170ml , aluminium hydroxide 200 mg,mg. hydroxide 200 mg. per 5ml sugar free liquid bottle packing of 170ml. , "dicyclomine 10mg./5ml. pack of 30ml " , "ambroxol 30mg,guaiphenesin 100 mg,terbutaline 2.5 mg/10ml syrup, bottles of 100ml. " , "dextromethorphan 10 mg ,phenylephrine 5 mg ,chlorpheniramine meleate 2mg/5ml syrup,bottles of 100ml. " , "azithromycin 200mg/5ml syrup/suspension ,bottles of 15ml. " , magnesium hydroxide 3.75 ml,liq. paraffin 1.25 ml, sodi. pico sulphate 3.33 mg bottles of 225ml. , "lactitol monohydrate 10 gm syrup/suspension pack of 200ml, " , "cetirizine 5 mg/5ml syrup/suspension bottles of 60ml." , "ondansetron 2 mg/5 ml syrup/suspension, bottles of 30ml. " , "paracetamol 250 mg/5 ml syrup/suspension, bottles of 60ml." , "montelukast 4mg, levocetrizin 2.5mg/5ml syrup/suspension bottles of 30ml." , "ambroxol 15 mg,guaifenesin 50 mg,terbutaline 1.25 mg 5ml syrup, bottles of 100-mlpadeiatric " , ofloxacin 100mg,metronidazole 200mg syrup, bottles of 60ml. , "ibuprofen 100mg,paracetamol 125mg/5ml syrup/suspension bottles of 30 ml" , "calamine and zinc oxide lotion... bottles of 100ml " , "beclomethasone dipropionate 0.025% w/w,phenylephrine hydrochloride 0.10% w/w,lignocaine hydrochloride 2.50% w/w,chlorocresol 0.1% w/w, pack of 20gm. " , povidone -iodine 2%w/v germicide gargle, pack of 100 ml bottle , chlorhexidine gluconate 0.2 %w/v mouth gargle , clotrimazole 1% w/w,beclomethasone 0.025% w/w (tube) pack of 15gm , "clindamycin 1% w/w,pack of 20gm " , "diclofenac 1.16, linseed oil -3,menthol 5,methyl salisylate 10,capsaicin 0.025...pack of 30 gm " , "diclofenac diethylammonium topical ,linseed oil topical... " , clobetasol 0.05%,miconazole 2%,tube of 15 gm packing , clobetasol 0.05%,salicylic acid 6%,tube of 30 gm packing , mometasone furoate 0.1% w/w (tube), pack of 15gm. , mometasone 0.1% w/w , fusidic acid 2% w/w (tube), pack of 10gm. , "triamcinolone acetonide 0.01 %w/w, pack of 5-10gm " , "ammonium chloride 0.5 %w/w,calcium lactate 0.5 %w/w,glycerin 3 %w/w,lactic acid 6 %w/w,magnesium chloride 0.3 %w/w,potassium chloride 0.5 %w/w,sodium chloride 0.5 %w/w,sodium dihydrogen phosphate 0.5 %w/w,urea 12 %w/w,ointment/cream " , "octinaxate,oxybenzone,zinc, avobenzone (spf 50) lotion pack of 50gm " , liquid paraffin 10.2 %w/w,white soft paraffin 13.2 %w/w gel/cream, pack of 100gm , "terbinafine 1% w/w powder, pack of 50-100gm " , "ketoconazole 2% w/w soap pack of 50-100gm " , ketoconazole shampoo 2% w/v pack of 60ml. , "itraconazole dusting powder 1% w/w, pack of 30-100gm " , luliconazole 1w cream/gel, pack of 50 gm , acyclovir 5% w/w cream, pack of 5gm , chloramphenicol 10 mg,polymycin b sulphate 10000 iu,dexamethasone 1 mg/1 gm ointment, pack of 5gm , "neomycin 3400 u,polymycin b 5000 u,bacitracin 400 u ointment, pack of 5-10gm " , chloramphenicol 10 mg,polymyxin-b 10,000 iu/1gm ointment, pack of 5gm , silver nitrate 0.2% w/w gel/cream (tube), pack of 10-30gm , silver nitrate 0.2% jar of 240 gms packing , ganciclovir 1.5mg/1gm w/w ophthalmic gel, pack of 5gm , "chlorhexidine 0.25%,metronidazole 1%/ gm gel, pack of 20-30gm " , "lignocaine 2% w/w gel (tube)with nozzle, pack of 30-60gm " , mupirocin 2% w/w ointment, pack of 5gm , "prilocaine 2.5% w/w,lidocaine 2.5% w/w oint. (tube), pack of 5gm to 30gm " , clotrimazole 1% w/v/ml lotion, pack of 15 ml , "clotrimazole 1% w/v,beclomethasone 0.025% w/v/ml lotion, pack of 15-30ml " , permethrin lotion 5% w/w, pack of 50-100ml , salbutamol 2.5mg./ml respule pack of 2.5 ml , salmeterol 25mcg,fluticasone 250mcg/puff , pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg,budesonide 200mcg/puff, pack of 120 metered dose with dose counter. , formoterol fumarate 6mcg, budesonide 400mcg/puff, pack of 120 metered dose with dose count

CTN :39786118

26 Mar, 2025 95.00 Lacs

Phalodi - Rajasthan

Tender For corrigendum : e tender for lab items - drabkin solution for hb estimation, tlc dilueting fluid, tlc pipette, dlc diluting fluid, dlc pipette, platelate count fluid, esr pipette disposable, anti a sera, anti b sera, anti d sera ( igg & igm), anti human globulin ( coombs reagent), normal saline, test tube glass 12 x75, test tube glass 12x100, droper plastic, slide pkt iso mark, cover slips 18x18, giemsa stain, leishman stain, paraffin oil, slide tray aluminum, distilled water, methanol, reticulocyte count fluid, methylene blue soln, brilliant cresyl blue soln, eosinophill count fluid, hemocytometer ( counting chamber ), bt ct capillary, filter paper, stop watch/timer, alcohol swabs, sickling test for sickle cell anemia, sickling rapid test for sickle cell anemia, nestroft test for screening of thalessemia, dcip for screening for hbe hemoglobinopathy, quantitative test g6pd deficiency, malaria rapid card test, pt reagent, sodium citrate tube for pt test, aptt reagent, calcium chloride soln, hcg ( pregnancy card), urine strips for ph,sg,tlc,glu,bil,uro,ketone,protein,nitrate, urine container plastic 30ml, test tube disposable plastic 12x100 ( 4 " ), urine strips for microalbumin, urine strips for acr, test kit for stool for ova and cyst, test kit for occult blood, semen diluting fluid, dengue rapid card test (igg,igm & ns1 ag combo), typhoid card test antibody, rpr /vdrl test for syphilis ( rapid card tests), rapid test card for the simultaneous detection of malara pv/pf antigen, s.thphi ( igm antibodies) and dengue ns1 antigen from a single card ( combo), hiv rapid card test with single step procedure ( serum and plasma), hbsag rapid card test 0.1 iu/ml senstivity, anti hcv rapid card test, rapid test card for the simultaneous detection of hiv 1& 2,hcv,hbsag ,syphilis from a single card ( combo), afb stain kit, widal test kit, blood sugar kit, gtt test kit, bilirubin total & direct kit, creatinine kit, urea test kit, uric acid test kit, sgpt test kit, sgot test kit, alkanine phosphate test kit, total protein test kit, albumin test kit, globulin test kit, total cholesterol test kit, triglycerides test kit, vldl direct test kit, hdl direct test kit, ggt test kit, amylase test kit, iron test kit, tibc test kit, hba1c test kit, s.calcium kit, s.magnesium test kit, acid phosphatest test kit, grams stain soln, thorat swap for diphitheria, visual inspection acetic acid, rk 39 for kala azar by rapid card test, smear for filaria, montex test 5tu, montex test 10tu, tuberculin syring for montex test, troponin i rapid card test, trop t rapid card test, ra quantitative test kit, crp quantitative test kit, aso quantitative test kit, blue tips, clot activator non vaccum tube double cap, edta nonvaccum tube double cap, jsb stain 1, jsb stain 2, keto stix, lugol iodine, methanol 5ltr, microscope bulb, printer paper roll 57mmx10mtr, printer paper roll 57mmx20mtr, sodium citrate soln, sodium hypochlorite soln, tissue paper roll, urine strips 04 parameter, yellow tips, electrolyte analyzer as per enclsoed technical specifications, 5 part hematology analyzer as per enclosed technical specifications, fully automated immunoassay analyzer ( clia) as per enclosed technical specifications, semi automated bioschemistry analyzer as per enclosed technical specifications

Liquid Ammonia Solution Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector

corporations/Associations/Others

State Government

Central Government/Public Sector