Latest liquid penetrant Tenders | Government liquid penetrant Tenders

CTN :39858766

18 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of lanthanum chloride , ammonium sulphamate , iodine resublimed , potassium carbonate , napthanol ar , methanesulfonic acid s , phthalein purple , methylene blue , orthophosphoric acid , mercuric iodide red , tin chloride dihydrate , bovin albumin , formic acid , formaldehyde solution , methanol hplc , diethyl ether

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

State Government

CTN :39200933

07 Apr, 2025 5.48 Lacs

Kutch - Gujarat

Tender For corrigendum : supply of fine chemical reagents & laboratory items for chemical laboratory at gsecl kltps - store code: 5910010029 1-amino 2-napthol 4-sulphonic acid, store code: 5931550041 ammonium molybdate ar ranbaxy, store code: 5931320001 barium chloride, store code: 5931330001 barium hydroxide lr, store code: 5915000002 barium sulphate, store code: 5934060001 benzyl alcohol, store code: 5916980008 bromothymol blue (ph 6.0-7.6), store code: 5930840001 calcium acetate ar, store code: 5916980014 erechrom black-t (solochrome black-t), store code: 5915760001 edta disodium salt ar/gr, store code: 5916600001 glycerol glaxo ar, store code: 5915980023 hydroxile amine hydrochloride, store code: 5915980025 indigo carmine, store code: 5933540001 oxalic acid ar, store code: 5916610003 methanol, store code: 5917200005 tarteric acid ar 500gms pkg, store code: 5932050001 methyl orange powder, store code: 5932050002 methyl red powder, store code: 5930890006 mercuric chloride, store code: 5930870003 magnesium chloride, store code: 5920200080 neda(1-napthyl ethylenediamine dihydrochloride), store code: 5950000017 nessler reagent, store code: 5934040003 iso-propal alchohol 2.50 ltrs. pack., store code: 5910051021 o tolidine reagent for chlorine testing 500 mls pack., store code: 5915980032 phenolphthalein powder, store code: 5930850027 potasium chloride 500 gram/bottle, store code: 5930850008 potassium cromate, store code: 5930850010 potassium di-hydrogen ortho-phosphate, store code: 5930850016 potassium iodate, store code: 5930850014 potassium hydroxide (pallets), store code: 5930850021 potassium permanganate powder, store code: 5930850023 potassium thiocynate, store code: 5930100002 silver nitrate, store code: 5910100001 sodium bi-carbonate, store code: 5910090005 sodium carbonate, store code: 5915350023 sodium hydroxide (pallets), store code: 5915350024 sodium meta bisulphite, store code: 5915350033 sodium thiosulphate, store code: 5930900002 stannous chloride, store code: 5932500002 starch, store code: 5915980035 sulphanil amide, store code: 5955030001 universal ph indicator solution 500 ml pack., store code: 5930120001 copper sulphate, store code: 5915350005 n/10 sodium thiosulphate ampouls, store code: 5945030001 pvc narrow mouth reagent bottle 1000 ml, store code: 5945030003 pvc narrow mouth reagent bottle 500 ml, store code: 5945030005 pvc wash bottle 500 ml, store code: 5945030006 pvc wide mouth reagent bottle 1000 ml, store code: 5945030008 pvc wide mouth reagent bottle 500 ml, store code: 5945600004 pvc buckets-15ltr

CTN :39792977

21 Apr, 2025 NA

Kochi - Kerala

Tender For procurement of paediatric preperations and drugs and consumable medical stores - drugs and consumables, caffein citrate 20mg/ml inj 1ml vial, midazolam nasal spray0.5 mg/spray 5 ml bottle, linezolid, dry powder 100mg/30ml, syp dicyclomine drops of 15 ml, ondansetron syp 2 mg/5ml in bott of 30 ml, prednisolone syp 5mg/5ml in bott of 30 ml, tab isoniazid 60 mg + rifampicin 60 mg, tab (dispersable) isoniazid 60 mg + rifampicin 60 mg + pyrazinamide 150 mg, alprazolam 0.25 mg tab, buspirone hcl 10 mg tab, chloridiazepoxide 10mg tab, chlorpromazine hcl 100 mg tab, clomipramine hcl 25 mg tab, clozapine 100 mg tab, fluvoxamine 50 mg cap, rivastigmine 9.5mg/24hrs, memantine 10mg tab, lithium carbonate 300 mg cap/tab, promethazine hcl 25 mg tab, risperidone 2 mg tab, risperidone 4 mg tab, aripiprazole 10 mg tab, atomoxetime 10 mg tab, olanzapine 10 mg tab, sertraline 50 mg tab, venlafaxine 37.5mg tab, zolpidem 10 mg tab, quitiapine 50 mg, tab, tianeptine 12.5 mg, tab, paroxetine xr 12.5, tab, tab amisulpride 200 mg, syp sucralfate 1000 mg/ 10 ml + oxetacaine 10 mg/ 10ml, bottle of 100 ml, pirfenidone 200 mg tab, ipratropium bromide respirator soln 500 mcg/2 ml respule, salbutamol sulphate 500 mcg/ml 1ml inj, levosalbutamol sulphate, 2.5 ml containing 1.25 mg, respule, tiotropium bromide 18 mcg & formoterol 12 mcg dry powder cap, dry powder delivery device compatible with pv-012478, 012480, 012481, 012482, formeterol fumarate 12 mcg dry powder, delivery device compatible with pv-012480, budesonide 200 mcg dry powder, formoterol 12 mcg & fluticasone 250 mcg dry powder, tiotropium bromide 18 mcg dry powder cap, cough syrup: each 5 ml containschlorpheniramine maleate ip 3 mg,ammonium chloride ip 110 mg, sodiumcitrate ip 46 mg, menthol ip 0.9 mg, bott of110 ml, syrup codeine phosphate 10 mg + chlorphenaramine maleate 4 mg per 5 ml bottle of 100 ml, syrup terbutaline sulphate 1.25 mg + bromhexine hcl 4 mg + guaiphenesin 50 mg per 5 ml bottle of 100 ml, amino acid preparation iv bott of 200-250ml, hydroxy ethyl starch 6% soln bott of 500 ml, potassium chloride liquid 20% bott of 200 ml, sterile water, amp of 10 ml, silodosin 4 mg tab, enzymatic detergent, antimicrobial hand gel containing ethyl alcohol 60% + cyclomethicone c12-15 alkyl lactate + cetyl lactate + phenoxyethanol + stearyl alcohol with moisturizer, povidone iodine 10% solution, bott of 100 ml, enteral feed powder, protein 85% short chain peptides 15%, free amino acids, fat 50%, mct 25% vet fat carbohydrate malto destri sachet of 126 gm, immuno booster enteral feed containing protein>13gm, fat32 gm enriched with omega-3 fatty acids and arginine, tpn 1 ltr triple chamber bag for central vein contain proteins 30-50 gm/i, lipid 30-45 gm/i glucose 100-160 gm/i, haemostatic sponge gelatin 80 mm long, 50mm broad 10 mm thick, 0.5% chlorhexidine acetate tulle grass dressing, cilostazole tab 100 mg, desmopressin acetate inj 4 mcg/ml, 1 ml ampoule, desmopressin nasal spray 100ug/ml in 5 ml bott, oxybutynin 2.5 mg tab, sildenafil citrate 50 mg tab, tolterodine tartrate 2 mg tab, drotaverine hcl 1%, 20 mg/ml, 2 ml inj, calcium carbonate 500mg tab (elemental),vit d3 500 iu tab, pyridoxine 100 mg, tab, vitamin b complex with a minimum concentration of vit b1-5mg, vit b6-3mg & vit b12-5mcg therapeutic tab/cap, b1, 50 mg inj, b 12, 500 mcg/ml inj, vitamin a solution ip 50 ml, iron syp paediatric each 5 ml containing elemental iron 25-50 mg and folic acid 500mcg bottle of 200ml, multivitamin drops with constituents having vit a, vit b1, bit b2, b6, vit c, vit d bottle of 15ml (dosages as per recommended daily allowances), niacin 500mg tab, infusion set for insulin pump, set of 10, dapagliflozin 5 mg tab, ethambutol 800mg tab, fluticasone propionate oint 0.005% tube of 10 gm, formeterol 6 mcg and budesonide 400 mcg ,cfc free, mdi, 120 metered doses, ipratropium bromide, delivery system for ipratropium bromide rotacap, salmeterol 50 mcg + fluticasone 250 mcg multi dose dry powder inhaler

State Government

CTN :39796680

26 Mar, 2025 NA

Burdwan - West Bengal

Tender For supply of gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade , gram stains kit , hiper sds-page teaching kit , acrylamide , sodium succinate , isoamyl alchohol , hiper plasmid dna cloning teaching kit , bacteriological agar , p-dimethy amino benzaldehyde , congo red , aniline blue , tricalcium phosphate , manganese sulfate , soil testing kit , sodium bicarbonate , potasium ferricynide , calcium carbonate , ethyl acetate , naoh powder , cupric sulfate , ammonium per sulfate , hiper pcr teaching kit , potassium dichromate , hiper antigen capture elisa teaching kit , agarose, ultrapure, low eeo , lamda dna , diluent for dna extraction , acetone dried , copper (ii) acetate monohydrate, hi-ar /acs , syringe filter 0.22 m diameter (pore size) , acetonitrile hplc grade , ortho phosphoric acid hplc grade

Central Government / Public Sector

CTN :39498647

31 Mar, 2025 NA

Panipat - Haryana

Tender For corrigendum : supply of ammonium carbonate

CTN :39538928

31 Mar, 2025 NA

Kapurthala - Punjab

Tender For corrigendum : purchase of chemicals - ethanol , methanol , acetone , dimethylformaamide , nmethyl-2-pyrrolidone , 1-ethyl-3-methylimidazoliumacetate , 1-butyl-3methylimidazolium chloride , 1-butyl-3- methylimidazoliumtetrafluoroborate , sulfuric acid , phospric acid , sodium hydroxide , potassium hydroxide , potassium carbonate , nickle on carbon , palladium on carbon 5 wt percent loading matrix activated carbon support , platinum on carbon , ruthenium on carbon , ammonium persulfate , sodium borohydride , glucose , mannose , alkali lignin , organosolv lignin , cyclohexane , benzene , cyclohexanol , toulene , xylene , potassium phostphate monobasic , 2,5-furan dicarboxyylic acid , 5- hydroxymethyl 1-2-furancarboxyylic acid , 5-formyl-2- furancarboxyylic acid , 2,5-diformylfuran , hmf 5- hydroxymethyl 1-2-furaldehyde , levulinic acid , sodium suplhate anhydrous , pyridine , hydrogen peroxide , choline chloride , acetamide , sulfolane , nickel ii chloride hexahydrate , sulfamic acid , lactic acid , ethylene glycerol , p-toluenesulfonic acid monohydrate , aluminimum chloride hexahydrate , aluminimum potassium sulfatedodecahydrate , iron iiichloride tetrahydrate , iron iii chloride hexahydrate , polyvinyl alcohol pva , acrylamide polymer 10 percent in water , polyvinylpyrrolidone , zeolite , alpha aluminum oxide , gamma aluminum oxide , zirconium iv oxide , cerium oxide , silver nitrate , copper nitrate hexahydrate , nickel nitrate hexahydrate , manganese ii nitrate tetrahydrate , cerium nitrate hexa hydrate , zinc nitrate hexahydrate , molybednum iv oxide , magnesium hydroxide , ruthenium chloride hydrate , lanthanum iii nitrate hexahydrate , niobium penoxide , niobium v chloride , monomagnesium phosphate , iron nitrate hexahydrate , silicon dioxide , nickel ii oxide , vandium pentoxide

Central Government And Public Sector

CTN :39731236

29 Mar, 2025 NA

Thane - Maharashtra

Tender For supply of acetonitrile hplc grade cas no. 75-05-8 , ammonium acetate cas no. 631-61-8 , ascorbic acid cas no. 50-81-7 , buffer capsules ph 4.00 20 deg c , buffer capsules ph 7.00 at 20 deg c , buffer capsules ph 9.20 at 20 deg. c , citric acid monohydrate cas no. 5949-29-1 , hydrochloric acid cas no. 7647-01-0 , methanol for hplc cas no. 67-56-1 , methanol specially dried for karl fischer reagents , oxalic acid cas no. 6153-56-6 , single reagent residual free chlorine test kit , sodium carbonate anhydrous cas no. 497-19-8 , sodium hydroxide pellets cas no. 1310-73-2 , sulphuric acid cas no. 7664-93-9

Liquid Penetrant Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government

State Government

Central Government / Public Sector

Central Government And Public Sector