Latest liquor scrap Tenders | Government liquor scrap Tenders

Central Government/Public Sector

CTN :39825536

07 Apr, 2025 NA

Pondicherry - Pondicherry

Tender For purchase of o.sml micro tube rack , odc mini cooler (blood collection tube) , odc mini cooler (thermo conductive rack) (ino/pk) , odc mini cooler lsml , 1 % dithiothreitol (dtt)-1 g , 1 % dithiothreitol (dtt)-sg , i.sml float rack- 8 places , 1 dc cooler (capacity 1 or 1.8) , 10ml syringe with needle , 10ml syringe with needle (22xl 1f4) , isml centrifuge tube (soo noslpk) sterile , isml centrifuge tube amber conical bottom , 18g needle , lxphosphate buffered saline ca& mg free (sooml) , ix tris edta- ph-7.0 , 2ml screw cap micro tube conical bottom , 20ml syringe , 2ltr plastic beaker , 3% hydrogen peroxide solution , soml centrifuge tube (soonos/pk) , soml centrifuge tube (soonos/pk) racked sterile , soml centrifuge tube large volume wire racks , soml vacuum filter/storage bottle system (12nos/pk) , 8 channel multi pipette (variable) increment 1 ".d with digital , display , 8 channel multi pipette (variable) increment 11-11 with digital , display , 8 channel multi pipette (variable) increment 11-11 with digital , display , a 72s0: n-acetyl-l-cysteine (1 ogm) , absolute alcohol-sooml , absorbent cotton roll , acetic acid glacial , aluminum foil , aluminum weighing boat (100nos/pk) , amber narrow mouth bottle 30ml , amber narrow mouth bottle 8ml (72nos/pk) , antiseptic urinary towelette , apron (white lab coat) full (medium) , apron (white lab coat) full (small) , apron (white lab coat) half sleeve (medium) , apron (white lab coat) half sleeve (small) , ast 2 tube carrier set, (pack of 3) , ast 5 tube carrier set, (pack of3) , ast carrier rack 8 set , ast carrier set -5 tube , auto clave label , autoclavable biohazard bags or specimen l2x24 inches (100 , nos/pk) , autoclavable biohazard bags or specimen 19x24 inches (100 , nos/pk) , bd serum vacutainer-4ml , bd serum vacutainer-6ml , bd vacutainer edta tube-4ml (cbc and hbaic) , bd vacutainer trace element plastic (100/pk) , bd vacutainer k2 edta trace element plastic (loo/pk) , bd vacutainer k2 edta plus 6m! (100/pk) , bd vacutainer safety lock blood collection sets, 21g, , 23gx3/4"xi2 (0.8xi9mmx305mm) (50nos) , bd vacutainer safety lock blood collection sets, 23g, , 23gx3/4"xi2 (0.6xi9mmx305mm) (50nos) , beaker 1000ml (20 per case) , beaker 100ml (20 per case) , beaker 500ml (40 per case) , biohazard waste container- 5ltr , blotting paper sheet , bottle with screw cap 1000m! , bottle with screw cap 500ml , bottle with screw cap 100ml , bottle with screw cap 50ml , bp handle- long & medium , carbol fuchsin (zn, strong) , carbol fuchsin practical grade , card board cryo box 36 places for 15m! centrifuge tubes , (8nos/pk) , card board cryo box 81 places for im1l2ml vials (8nos/pk) , card board cryo box 100 places for iml/2ml vials (8noslpk) , card board cryo box 25 places for 1 m1l2ml vials (8nos/pk) , cedarwood oil , cello chiller box (3l, 8l, 12l, 14l, 20l) (without tap) , champ autoclavable variable volume pipettor (20-200ml) , chromotrope 2r , collapsible space saver rack (2 nos/pk) , combilok (4 nos/pk) , conical centrifuge tube rack (l/pack) , conical flask 100 ml , conical flask 150 ml , conical flask 250 ml , conical flask 50 ml , conical flask 500 ml , coup lin jar places-1 0 , corning 2ml external threaded polypropylene cryogenic vial , self- standing with round bottom (500/pk) , cover slip, rectangular- 22mrnx40mm , cover slip, square- 22mmx22mm , cryo apron 42" , cryo cube box 100 places (4nos/pk) , cryo cube box 25 places (8nos/pk) , cryo cube box 50 places (8nos/pk) , cryo cube box 81 places (4nos/ pk) , cryo cube box 81 places (4noslpk) , cryo gloves (medium) , cryo label nitro tag , cryo laser babies (1.28xo.50mm) , cryo marker , cryopure tubes, 2ml white, internal thread , cryo racks, (50 place) , cryo tags (l.50xo.75) , cryo vials 1.8-2ml (500nos /pk) (self-standing with external , thread) , cryo vials 1.8-2ml (500nos /pk) (self-standing with internal , thread) , cryogenic barcode label l "x 1 " , cryogenic permanent marker blue , cryo vials 1.oml, sta

Central Government/Public Sector

CTN :39694350

07 Apr, 2025 NA

Kalol - Gujarat

Tender For corrigendum : supply of isopropyl alcohol (ipa) (ongc),isopropyl alcohol (ipa) (ongc),isopropyl alcohol (ipa) (ongc),isopropyl alcohol (ipa) (ongc),isopropyl alcohol (ipa) (ongc),isopropyl alcohol (ipa) (ongc),isopropyl alcohol (ipa) (ongc),isopropyl alcohol (ipa) (ongc)

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

Central Government/Public Sector

CTN :39826384

22 Apr, 2025 NA

Dibrugarh - Assam

Tender For tender for supply of surgical and consumables hospital furniture etc to assam medical college hospital dibrugarh - supply of surgicals, consumables and hospital furniture, absolute alcohol, absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip 300gm roll, adhesive tape 7.5cm x 5 mtr spool, alcohol swab, aldheyde free disinfectant, anti septic solution 1000 ml, bandage 90cm x 18mtrs,, betadin ointment tube/nanz/ collapsible tube, betadin solution 500ml (5%), bleaching powder, cannula fixer, cidex solution 2.45% 1000 ml, collagen sheets 10 x 10cm, cotton crepe bandage b.p. size: 4mtr x 6 cm, cotton roll 500gm, disinfection solution 5 ltrs jar, elastic adhesive bandage 10cm x 1mtr, formalin, gauge cloth 90cm x 18mtr, gauge swab non sterilized, gauge swab sterilized, glycerol, hand sanitizer, hand wash 500ml bottle/, hydrogen peroxide, hypoallergenic non-woven tape, size: 5m x 2.5cm, hypoallergenic non-woven tape, size: 5m x 5cm, lysol, mackintosh sheet, methylated spirit 1 ltr jar, micro-porous plaster size: small/each box, micro-porous plaster size: big/each box, paper adhesive size: 1" x 9.0 mts, paraffin gauge dressing b.p. size: 10cm x 10cm, phenyl 450 ml bottle, phenyl solid, plaster of paris bandages bp size: 15cm x 2.7 mts, plaster of paris bandages bp size: 10cm x 2.7 mts, raxin sheet, rectified spirit 450ml, roll bandage 10cm x 5mtrs, rolled bandage 5cm x 5mtrs, 100gm/doz, rolled bandage 5cm x 5mtrs, 60gm/doz, savlon, senitary napkin, sodalime 5kg jar, surgical gauge pad, back rest, bed side screen 4 fold, biomedical waste bin trolley, door screen white, size: 200cm x 114cm/, dressing trolley, dressing trolley big size, ecg trolley, foot step (double step), foot step (single step), fowler bed (deluxe), hygiene trolley, icu bed (fowler), icu bed (mannual), icu bed with remort control, instrument trolley, instrumet cabinet, medicine cabinet, medicine trolley, mosquito stand, orthopedic bed, oxygen cylinder carrying trolley, oxygen cylinder trolley (d-type) 140cm hight tubular ms frame work fitted with wheel 125mm dia., patient carrying trolley, patient examination bed, patient examination couch, patient examination table, pediatric bed, revolving stool, revolving stool ss, saline warmer, semi fowler bed, semi fowler bed (super) with mosquito net stand, sevotec veporiser, stretcher, stretcher on trolley, waiting chair (regular), ward bed (general), wheel chair, mosquito artery forceps, speculam, pvc pipe for central line, reservior bag for anaesthesia machine, anathesia face mask 0,1,,2,3, black rubber mask 1,2,3,4, uterine sound, towel clip, ecg paper for schiller machine model at2 per packet, ecg paper for edan machine per packet, laryngeal mask airway size 1,1.5,2,2.5, i gel size 1,1.5,2,2.5, bowl stand, sterlized drum trolley, volcellum, post vaginal well retractor, cup t removal hook, anti vaginal well retractor, cunalty, coscors self retractor, angle lip retractor, hegari dilator, theraputic paraffin wax, absolute alcohol (denaturated alcohol), absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip, 300 gm roll, adhesive tape, 7.5cm x5mtr spool, alcohol swab, aldheyde free disinfectant, all container vial ( non vaccum, non iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, etc., all container vial (vacuum, iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, z no add, k2, k3, allies tissue forceps, size: 6 , 8 , autoclave big, size:big, autoclave, size: medium, autoclave, size:small, b.p. bulb, b.p. handle stainless steel, size: 3, b.p. handle stainless steel, size: 4, bandage cloth, size:90cm x 18mtrs, 325gm, barium sulphate 5 kg jar, bed pan, betadin solution 500ml (5%), bleaching powder, blood administration set disposable sterilized, bp blade, size: 11,15,20,21,22,23,24, bp instrument stand type, bp instrument (mercurial) table model, b.p instrument (digital), cannula (3 way), cap (disposable), carbon di oxide b-type cylinder (as per latest iso s

Co-operative

CTN :39810550

01 Apr, 2025 90.00 Lacs

Jaipur - Rajasthan

Tender For e-tender document for supply of lab chemicals and glass ware / potassium permaganate/surgical gloves / iso amyl alcohal - potassium permagnate crystal (commercial grade), tsp (tri sodium phosphate) commercial grade, salt a (per 500 ml pack), absolute ethanol (per 500 ml pack), sulphuric acid lab grade ( 5 lit. plastic jar pack), iso amyl alcohol lab grade (500ml pack) (melting point:- 117.2 degree c) (boiling point:- 131 degree c ) density:- 0.810 kg/1,) (solubility:- water 25 g/1 at 20 degree c) refractive index:- 20/d 1.4053 physical description :- liquid, qualigens, e-merck, cdh, qualikems, rankem, lab chemicals & glassware, ranbaxy, sd fine, glaxo / qualigens universal, e-merck, loba, himedia, borosil, duran (germany) / ravira, qualikems, supertek, satol, polylab, religlass, cdh, whatman, diversey, dorson, moxcare, abdos, butyrometer ( benny make), for cream, for butter, for milk, for cheese, surgical gloves sterlized size 7.5" & 8", surgical gloves non-sterlized size 7.5" & 8", nitrile gloves(food grade), halyard, moxcare, labserv, kimberly-clark, cotton absorbent 500 gm / 400 gm pack, cotton non-absorbent 500 gm / 400 gm pack, disposable cap, disposable face mask, thermometer 0-110 deg.c (dimple make), type:alcohol, type:mercury, lactometer-(20 to 40 range) 15.5 c, jupitor, benny, jk, lactometer supreme quality dual tested range:0-40@84 deg f,accuracy: 0.0002, division:0.001 (jk make), lock stopper (make benny), rubber cork no.1 for test tube, edta commercial grade, pipette 10.75 ml super delux benny make, water bath- ordinary, water bath- serological, water bath- with thermostatically, hot air oven (s.s.), hot plates round, 8 inch, 12 inch, b.h.a. food grade, digital thermometer- 10 deg.c to 250 deg.c, b.r. meter, distilled water, filter paper grade 4, size:125 mm, dorson, whatman, filter paper grade 41, size:125 mm, dorson, whatman

corporations/Associations/Others

CTN :39668994

31 Mar, 2025 NA

Ranchi - Jharkhand

Tender For corrigendum : supply of magnesite alcohol base paint

corporations/Associations/Others

CTN :39669046

31 Mar, 2025 NA

Ranchi - Jharkhand

Tender For corrigendum : supply of zircon alcohol base paint

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39089124

10 Apr, 2025 NA

Srisailam - Telangana

Tender For corrigendum : supply of 3nos. alcohol breath analyzers with wifi, touch screen colour display and 50000 tests record memory with all information for slbhes, srisailam dam west, nagarkurnool (dist) - 509326, telangana.

CTN :39673444

28 Mar, 2025 NA

Hyderabad-T - Telangana

Tender For corrigendum : supply of glass cleaner, liquid (v2) as per is 8540 (q4) , toilet cleaner liquid (v2) conforming to is 7983 (q4) , sweeping broom (v3) (q4) , squeegee washer wiper mopper (v2) (q4) , air freshener solid and gel (q4) , alcohol based hand sanitizer (q2) , toilet soap as per is 2888 (v2) (q4) , toilet brush (v2) (q4) , high density polyethylene bucket (q4) , mosquito repellant cream spray and lotion (q4)

Liquor Scrap Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors