Latest locating plate Tenders | Government locating plate Tenders

Central Government And Public Sector

CTN :39357268

29 Mar, 2025 1.84 Crore

Chandigarh - Chandigarh

Tender For bid to ras corrigendum : supply of sitc of 1500 kva ea set , sitc of sandwich type compact aluminum conductor bus-duct , 350 mm dia ms pipe 5 mm thick , 400 mm dia ms pipe 5 mm thick , ms cchannel angle iron flats base platesnuts and bolts , providing and fixing thermal rockwool insulation of exhaust pipeline by lrb , earthing with copper earth plate 600 mm x 600 mm x 3 mm thick , providing and fixing 25 mm x 5 mm copper strip in 40 mm dia g.i. pipe , providing and fixing 25 mm x 5 mm copper strip on surface or in recess for connections etc. as required. , earthing with gi earth plate 600 mm x 600 mm x 6 mm thick , providing and fixing 25 mm x 5 mm gi strip in 40 mm dia g.i. pipe , providing and fixing 25 mm x 5 mm gi strip on surface or in recess for connections etc. as required.

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39446776

29 Mar, 2025 NA

Jammu - Jammu And Kashmir

Tender For bid to ras bid to ras tender for supply of tramadol hcl 50 mg tab, fenofibrate 200 mg tab, isosorbide dinitrate 10 mg tab, isosorbide5 mononitrate 20 mg tab, isapgol ispaghula husk 3poin5 gm, carbimazole 5 mg tab, bimatoprost 0poin03per bott of 3ml eye drop, betahistine dihydrochloride 8mg tab, vita b complex therapeutic tab with minim concentraton of vit b15mg vit b63mg and vit b125mcg, diclofenac sodium sr 100mg tab, cyproheptadine 4 mg tab, carbamazepine 200 mg cr tab, clobazam 5 mg tab, diazepam 5 mg tab, canagliflozin 100mg tab, sulphamethoxazole 400 mg and trimethoprim 160mg tab, anastrazole 1mg tab, carvedilol 12poin5 mg tab, diltiazem 60 mg tab, rosuvastatin 5mg tab, enalapril maleate 10 mg tab, enalapril 5 mg tab, triamcinalone acetate 0poin1per for oral use tube of 5gm, pancreatic enzyme casules with lipas conten of 10000 to 20000 unit, human insulin analogu long acting inj 100 iu ml recombinan dna origin 300 iu disposabl pen with 5 nedle per pen, vildagliptin 50mg tab, sitagliptin 50mg plus metformin 1000mg tab, cyproheptadine hcl 2 mg 5ml bott of 100 ml syp, duloxetine 20 mg tab, zidovudine 300 mg plus lamivudine 150 mg plus nevirapine 200mg tab, thyroxin sodium 75 mcg tab, syp iron 80mg 5ml bott of 200 ml, diclofenac spray, gel adapalene 0poin1per plus clindamycin 1per phosphate tube of 15gm, tab acenocoumarol 3 mg, tab taurine plus acetylcystene 150 500mg, amisulpride 50 mg tab orodispersible, amlodipine 2poin5mg tab, betamethasone valerate 0poin1per oint tube 20 gm, calamine lotion bott of 100ml, tab cilnidipine 10 mg, cream clobetasol 0poin05per plus salicylic acid 3per tube of 15gm, clonazepam 0poin25mg tab, tab diacerin 50 mg plus glucosamine 750 mg, tab diclofenac potassium 50mg plus serriopeptidase 10mg, faropenem 200 mg tab, tab etoricoxib 60 mg, fluvoxamine cr 100 mg tab, glimepride 1mg plus metformin 500mg tab, glimepride 2mg plus metformin 500mg tab, tab nitroglycerine 6poin4mg, lamotrigine 100 mg tab, cremafin whit each 15 ml containg milk of magnesia 11poin25 ml liq parafin 3poin75ml botl of 170 ml syp, mecobalamine 500mcg tab, mesalamine sachet 1000mg, multivitamin syp bott of 200ml, naproxen 250 mg plusdomperidone 10 mgtab , olmesartan 20mg tab, pregabalin 75 mg plus methylcobalmin 750 mcg tab, pyridoxine 40mg tab, rabeprazole 20 mg plus domperidone 10 mg tab, tab risperidone 1mg, sodium valporate 500mg tab, chlordiazepoxide 5mg plus clinidium 2poin5mg tab, knee cap l, syringes disposable 10ml, bandage open wove uncompressed 10 cm x 4 metres, gauze surgical open wove unmedicated 60 cm wide length 18 mtr, syp digestiv enzym containg atleast four constituent pepsin fungal, tab eplerenone 50mg, e d brimonidine 0poin2per plus timolol 0poin5per bott of 5ml, brinzolamide 1per plus timolol 0poin5per eye drops bott of 5 ml, budesonide 200 mcg dry powder, tab coenzyme q10 mg, cough lozenges tab, tamsulosin 0poin4 mg plus dutasteride 0poin5 mg tab, sitagliptin 50mg tab, colostomy bag plus base plate 60mm, urostomy kit size 50mm urostomy bagplus base plate , tab levodopa 100 mg plus carvidopa 10 mg, bisoprolol 1poin25mg tab , brimonidine 0poin15per eye drop preservative free, formetrol 6mcg plus budesonide 200mcg respule, tolvaptan 15 mg tab, imeglimin 500mg tab, lenvatinib 8mg tab, tetrabenazine 25mg revocon tab, cintapride 3mg tab, tab dasatinib 100 mg, oint povidone iodine 10per w w tube of 15gm, tab etoricoxib 90 mg, bromhexine 5 ml containing 4 mg of bromhexine hcl bottle of 120ml syp, methylprednisolone sodium succinate 40 mg inj of 2 ml, fexofenadine hydrochloride 120 mg tab, methyl prednisolone sodium acetate 80 mg inj, alfuzocin 10mg tab, thiocholchicoside 4 mg cap, atorvastatin 10mg plus fenofibrate 160mg tab, tab diclofenac 50mg plus paracetamol 325 mg pluschlorzoxazone 250 mg, mesalamine 400 mg tab, metoprolol 25mg tab

CTN :39835509

15 Apr, 2025 NA

Sonitpur - Assam

Tender For supply of construction material of ug comd post bn hq - ms anchor bolt and all other specification as per rfp , ceramic tiles and all other specification as per rfp , white cement and all other specification as per rfp , curtain arrangement drapery and rod and all other specification as per rfp , coarse sand and all other specification as per rfp , coarse aggregate and all other specification as per rfp , stone boulder and all other specification as per rfp , pvc pipe and all other specification as per rfp , coarse sand and all other specification as per rfp , hardcore and all other specification as per rfp , brick and all other specification as per rfp , three phase monoblock pump and all other specification as per rfp , distribution box and all other specification as per rfp , mcb spn and all other specification as per rfp , mcb sp and all other specification as per rfp , pvc tape and all other specification as per rfp , cable and all other specification as per rfp , pvc casing capping and all other specification as per rfp , modular switch piano and all other specification as per rfp , led tube light fittings and all other specification as per rfp , led mirror lights and all other specification as per rfp , screw and all other specification as per rfp , pvc switch board and all other specification as per rfp , pvc l bend and t junction joint and all other specification as per rfp , modular switch socket combination and all other specification as per rfp , service bracket and all other specification as per rfp , service cable and all other specification as per rfp , ceiling rose and all other specification as per rfp , led bulk head fitting and all other specification as per rfp , pvc flexible wire and all other specification as per rfp , pvc flexible conduit pipe and all other specification as per rfp , pvc round squire block and all other specification as per rfp , exhaust fan and all other specification as per rfp , fire extinguisher and all other specification as per rfp , earthing plate and all other specification as per rfp , ci earth pit cover and all other specification as per rfp , funnel fitted and all other specification as per rfp , gi wire and all other specification as per rfp , charcoal and all other specification as per rfp , salt and all other specification as per rfp , air termination and all other specification as per rfp , testing point terminal block and all other specification as per rfp , aluminium strips and all other specification as per rfp , galvanized iron strip and all other specification as per rfp , insulating pvc block and all other specification as per rfp , double sleeping bunk and all other specification as per rfp , steel bed side locker and all other specification as per rfp , study chair and all other specification as per rfp , study table and all other specification as per rfp , looking mirror and all other specification as per rfp , peg set of six and all other specification as per rfp , water dispenser and all other specification as per rfp , kero heater and all other specification as per rfp , individual standalone plastic body smoke alarm and all other specification as per rfp , individual standalone plastic body heat alarm and all other specification as per rfp , fire ball extinguisher and all other specification as per rfp

CTN :39835524

15 Apr, 2025 NA

Sonitpur - Assam

Tender For supply of construction material - ms anchor bolt and all other specification as per rfp , ceramic tiles and all other specification as per rfp , white cement and all other specification as per rfp , curtain arrangement drapery and rod and all other specification as per rfp , coarse sand and all other specification as per rfp , coarse aggregate and all other specification as per rfp , stone boulder and all other specification as per rfp , pvc pipe and all other specification as per rfp , coarse sand and all other specification as per rfp , hardcore and all other specification as per rfp , brick and all other specification as per rfp , three phase monoblock pump and all other specification as per rfp , distribution box and all other specification as per rfp , mcb spn and all other specification as per rfp , mcb sp and all other specification as per rfp , pvc tape and all other specification as per rfp , cable and all other specification as per rfp , pvc casing capping and all other specification as per rfp , modular switch piano and all other specification as per rfp , led tube light fittings and all other specification as per rfp , led mirror lights and all other specification as per rfp , screw and all other specification as per rfp , pvc switch board and all other specification as per rfp , pvc l bend and t junction joint and all other specification as per rfp , modular switch socket combination and all other specification as per rfp , service bracket and all other specification as per rfp , service cable and all other specification as per rfp , ceiling rose and all other specification as per rfp , led bulk head fitting and all other specification as per rfp , pvc flexible wire and all other specification as per rfp , pvc flexible conduit pipe and all other specification as per rfp , pvc round squire block and all other specification as per rfp , exhaust fan and all other specification as per rfp , fire extinguisher and all other specification as per rfp , earthing plate and all other specification as per rfp , ci earth pit cover and all other specification as per rfp , funnel fitted and all other specification as per rfp , gi wire and all other specification as per rfp , charcoal and all other specification as per rfp , salt and all other specification as per rfp , air termination and all other specification as per rfp , testing point terminal block and all other specification as per rfp , aluminium strips and all other specification as per rfp , galvanized iron strip and all other specification as per rfp , insulating pvc block and all other specification as per rfp , double sleeping bunk and all other specification as per rfp , steel bed side locker and all other specification as per rfp , study chair and all other specification as per rfp , study table and all other specification as per rfp , looking mirror and all other specification as per rfp , peg set of six and all other specification as per rfp , water dispenser and all other specification as per rfp , kero heater and all other specification as per rfp , individual standalone plastic body smoke alarm and all other specification as per rfp , individual standalone plastic body heat alarm and all other specification as per rfp , fire ball extinguisher and all other specification as per rfp

CTN :39828058

22 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For supply of lab equipment - lab equipment, chest auscultation trainer, abdominal examination trainer, injections and iv trainer, iv infusion and calculation of drip rate, cpr training, oxygen therapy, aerosol therapy or nebulization, full body manikins-multipurpose, enema trainer, ryle s tube insertion model, pleural and ascitic fluid aspiration model, urinary catheterization male model, urinary catheterization female model, basic incision and suture trainer, incision and drainage trainer, basic fracture and dislocation man agement trainer, prostate examination trainer, per-rectal examination trainer, ophthalmoscope, fundoscope, dermo scope, ent examination set, paediatric iv infusion and, calculating drip rate model, neonatal resuscitation model, nursing trainer for decubitus, blood sampling, thermal scanner, pulse oxemeter, iron footstep 02 step, intravenous (iv) stand with stainless steel rod and castor base, patient transfer stretcher trolley, steel drug trolly, sututing set best quality, multi para monitor, suction machine, suction catheter, resuscitation kit, oxygen unit with nasal hood/mask, laryngoscope, endotracheal tube, ambu bag with different mask, defibrillator, electrocardiogram and monitor, neonatal/paediatric blood pressure cuff, icu-thermometer, neonatal intensive care unit thermometer, knee hammer, diagnostic electrocardiogram machine twelve channel, strecher cum trolley, intravenous stand, lamp stand, bp apparatus (mercury), royal facial gel 100 ml, suction pipe, nubuvb lamp, xylocaine gel, xylocain spray, cauterage needle, ups analyser, glass washing shampoo, micropipette stand, merill cell counter diluent set, disposable bed sheet, silbatta small, silbatta medium, silbatta large, kharal (pestle and morter) sange marmar, kharal (pestle and morter) sange siyah, kharal (pestle and morter) sange summaq, kharal (pestle and morter) porcelain, kharal (pestle and morter) iron, distillation apparatus including traditional apparatus such as qara ambiq, nal bhabka, patal jantar, jal jantar, damru jantar, tareeqe lolabi, tareeqe habli, hammame mayiya etc., havan dasta (for pounding), boota (crucibles), putt (bhatti), phunkni (blower), choolha or angeethi (charcoal or wooden block), hot plate, physical balance, electronic balance, chemical balance, brass vessels and containers, copper vessels and containers, steel vessels and containers, iron vessels and containers, mud or earhen vessels and containers, frying pan, spatula, ladle and spoon, steel plates, enamel tray, plastic tray, jars and containrs, mixer grinder, wet grinder, pyrometer, refrigerator big, knives, scrappers, chopping pad, porcelain jars for fermentation purpose, sieves (different size and numbers), juice extractor, spirit lamp, tablet disintegration apparatus, muffle furnace, soxhlet appratus with heating unit, magnetic stirrer, titration tube, glass distillation appratus, steel distillation appratus, digital ph meter, tablet hardness tester, tablet friability tester, tablet dissolution tester, hydrometer, alcohol determintion appratus, vernier caliper, heating mantles, bulk density tester, ratary shaker, ultraviolet spectro photometer, refratometer, hot air oven, microwave oven, pyrometer, pycnometer or specific gravity bottle, microscope with software (motic or carlzesis), microtome, microslide cabinet, dissection box, aluminium side trays, ocular micrometer, stage micrometer, camera lucida prism type and mirror type, boiling point and melting point determination apparatus, volatile oil determination apparatus, viscometer (ostwalds redwood), glassware (beakers, funnel, test tubes, measuring cylinders, conical flasks, glass rod, dropper), flask shaker, slide with cover slip, litmu paper (blue and red), hydrion ph paper, test tube rack, filter paper, round bottom glass with iros mesh, platinum wire, watch glass, dehumidifier, liquified petroleum gas cylinder with burners, silica curcible, moisture determination apparatus, conductivity meter (hand operate

CTN :39817428

02 Apr, 2025 10.61 Lacs

Raichur - Karnataka

Tender For construction of santhe katte work at yergera village , yergera gp, tq dist-raichur - whitening yergerasanthe2251, dry distemper yergerasanthe2251, border tiles 30 x 10 cms yergerasanthe2251, glazed tiles 300x450 yergerasanthe2251, granite stone slabs fine dressed 40 mm thick yergerasanthe2251, enamel metal paint yergerasanthe2251, ready mix primer paint ready mix red lead paint yergerasanthe2251, corbon electrodes yergerasanthe2251, anchor bolts 750mm yergerasanthe2251, base plate base plate yergerasanthe2251, gusset plates 6 mm thick yergerasanthe2251, ms angle iron 50x50x6mm yergerasanthe2251, ms angle iron 50mm x 50mm x 6mm 33 8 metre in length at 4 5 kg per metre yergerasanthe2251, unit cost as per the specification yergerasanthe2251, gravel 236 mm murrum yergerasanthe2251, casurina poles 100 150 mm yergerasanthe2251, brick yergerasanthe2251, binding wire yergerasanthe2251, tmt bars fe 500 yergerasanthe2251, plasticizer super plasticizer yergerasanthe2251, portland cement yergerasanthe2251, broken stone aggregate 12 mm to 10 mm size yergerasanthe2251, broken stone aggregate 20 mm size yergerasanthe2251, broken stone aggregate 40 mm size yergerasanthe2251, coarse sand zone iii yergerasanthe2251, granite/trap broken metal 100 mm and down size yergerasanthe2251

CTN :39824185

09 Apr, 2025 NA

Khandwa - Madhya Pradesh

Tender For civil construction material and other services supply - notice inviting item rate of various item for maintanance & repair work at omkareshwar, 6mm machine broken aggregate, 10mm machine broken aggregate, 12mm machine broken aggregate, 20mm machine broken aggregate, 40mm machine broken aggregate, river sand, balu sand, moorrum, gobar khad, stone dust, brick open bhatta, black soil, cement isi mark 43 grade, cement isi mark 53 grade, hot rolled hyysd bars isi marked 6mm, hot rolled hyysd bars isi marked 8mm, hot rolled hyysd bars isi marked 10mm, hot rolled hyysd bars isi marked 12mm, hot rolled hyysd bars isi marked 16mm, hot rolled hyysd bars isi marked 20mm, hot rolled hyysd bars isi marked 25mm, plastic paint of approved brand isi marked, iron jaali,angle ,tube,door,window,chamber plate all type including fitting etc, corrugated gi sheet isi mark, acp pannel installation re erection opening etc, painting steel work including material etc, painting rcc work boundary wall etc including material etc, cement brick, red farsi 40mm thk, kota stone 20mm thk, mosaiqe tiles 20mm thk, glazed tiles 6 mm thk, granite 20mm thk, vitrified tiles, mixer machine including fuel operator etc, viberator including fuel operator etc, concrete breaker machine, latrine seat indian, urinal, jcb machine including fuel operatoe etc, distember oil bound of approved brand isi mark, tarpin, centering material complete, paver block 80mm thk, treegaurd, drainage chamber cover cast iron, rcc pipe np3 150mm dia, rcc pipe np3 200mm dia, rcc pipe np3 250mm dia, rcc pipe np3 300mm dia, rcc pipe np3400mm dia, rcc pipe np3 450mm dia, rcc pipe np3500mm dia, rcc pipe np3 600mm dia, rcc pipe np 31000mm dia, rcc pipe np3 1200mm dia, writing work on stone all types, pot hole repair of existing bituminous roads with hot mix bituminous material and aggregates confirming to specifictation 504 including cleaning of surface cutting edges of pot holes patches in desired shape and rolling complete including labour, black stone/material m sand, white cement, whilte lime chuna, oil paint, poclain machine including fuel operator etc, tractor with tralli including fuel operator etc, pvc pipe 6kg 160mm dia, pvc pipe 8kg 160mm dia, pvc pipe 6kg 90mm dia, pvc pipe 4kg 75mm dia, profilce sheet isi mark

CTN :39793600

28 Mar, 2025 10.00 Lacs

Dindigul - Tamil Nadu

Tender For suppling of public health material in sriramapuram town panchayat - bleaching powder (for water supply) isi grade 33% chlorin 1065 grade no.2, bleaching powder (for public health) isi grade 22% chlorin 1065 grade no.2, black phenoyl, abate 50% ec, hydrated lime powder, pyrethrum 2% extract, baytex 1000, fogg m/c. lpg cylinder, emi solution, organic jaggery (naatu vellam), fenthion 82.5% e.c, tempephos 50% ec, round up / glyphosate ( kalai kolli ), 2-4d oil, alum(sulphate of aluminium ferric), malathion, acid, bio larvicide, bt powder, non ferric acid, lysol, alcohol hand sanitizer, sodium hypo chloride, mask, n95 mask, gloves, a. 12" gloves, b. 18" gloves, c. oneside rubber coated gloves, d. surgical gloves, e. cotton gloves, mask, a.n95 mask, b. three layer, c. cotton mask, ppe kit, e.b gloves, cap, helmet, overcoat, foot boot, rain coat, reflector coat (green/orange), sweeper s coat (green) with sleeve, 50 litre can pull cart, 80 litre can pull cart, broom stick with handle, broom stick (thudaippam), crowbar (kadaparai), shovel with handle, forque with handle, pickaxe with handle, slump cleaner with handle ss(gi plate ), fiber ghamela small, fiber ghamela big, bamboo ghamela small, bamboo ghamela big, pull / push cart (two wheeler), pull / push cart (four wheeler), pull/push cart wheel tube, pull/push cart tyre, machete with handle (aaruval) big, machete (kaarukaruval) small, 3 mamooty with handle (kotthu), 6 mamooty with handle (kotthu), mamooty with handle, power sprayer heavy (fuel operated), power sprayer heavy (battery operated), g i bucket ( rice mill ), slump cleaner with handle ( agappai ), wooden handle for mamooty, pickaxe, kundalam, iron ghamela, pump stick miller with handle, 12 g i bucket, plastic mug, road cleaning brush, aluminium ghamela ( annakudai ), 200 litre can pull cart, action m l o, kundalam, bamboo ghamela (thattukoodai), calcium hpo choride soultion, hand wash liquid, covid 19 - bio medical waste yellow bag, hand gloves ( cotton , synthetic mixed), hand gloves ( synthetic ), one time use hand gloves, face shield safety & use, face mask ffp 1, medical infrared fore head thermometer, pulse oximeter, white phenyl, toilet cleaner thick liquid, lemon grace flavour soap oil, lemon grass oil, room fresher - perfume, full face chimical proofed gas mask (with filter), nitrile rubber hand gloves, pollution safety mouth, chappal (ladies & gents), safety nylon cap, raxin cap, sprayres ( 12 liters capacity), sprayres ( 16 liters capacity), coconut bamboo milar, canal spoon grip ( kongani), small fork with fork handle ( ), 50 ltrngarbage bin, garbage disposal plate ( ), sickle (small), bretex - for larve control, 5 lit bucket (plastic), , ( ), bleaching water, soap oil, reponsar (beta cyfluthrin 2.45 sc flying insect killer), ammonium sulphate, king fogg - high fogg ( delta methrin 1.25 ulv), reflector jacket, mamooty with handle, forque with handle, pickacc with handle, tata shovel with handle, crown bar, drainage mamooty with handle, fibre gamalish, bamboo gamalish - big, glouse, foot boot, cart type, cart tube, over coat, 50 litres can, broom stick, mask, 10" gi bucket, 12" gi bucket, gi mug, brush, bill hook, grass cutter with handle, coco broom stick with bamboo handle, 3" mamooty with handle (koththu), 6" mamooty with handle (koththu), kundalam, fibre ghamela - big, fibre ghamela - small, bamboo gamalish - small, iron ghamela, aluminium ghamela (annakudai), pull / push cart (two wheeler), pull / push cart (four wheeler), 200 litre can pull cart, machete with handle (aruval) -big, machete with handle (aruval) -small, slum cleaner with handle (gi plate), slum cleaner with handle (agappai), pump stick miller with handle, wooden handle for mamooty, pickace, kundalam, action m l o, helmet, cart tyre ( pull / push cart tyre), cart tyre ( pull / push cart wheel tube), 80 litres can pull cart, road cleaning brush, bamboo with handle, reflective jocket, bell, rice mill g.j bucket, bamboo plate, plastic bucke

CTN :39824725

04 Apr, 2025 10.00 Lacs

Tuticorin - Tamil Nadu

Tender For supply of public health conservancy materials in nazareth town panchayat. - mamooty with handle, forque with handle, pickace with handle, tata shovel with handle, crown bar, drainage mamooty with handle, 3" mamooty with handle (koththu), 6" mamooty with handle (koththu), kundalam, fibre ghamela - big, fibre ghamela - small, bamboo ghamela big, bamboo ghamela small, bamboo ghamela, iron ghamela, aluminium ghamela (annakudai), pull / push cart (two wheeler), pull / push cart (four wheeler), 200 litre can pull cart, machete with handle (aruval) - big, machete with handle (aruval) - small, slump cleaner with handle (gi plate), slump cleaner with handle (agappai), pump stick miller with handle, wooden handle for mamooty,pickace,kundalam, action m l o, foot boot, helmet, cart tyre (pull/push cart tyre), cart tube (pull/push cart wheel tube), 50 litres can (bin), 80 litre can pull cart, broom stick, 10 gi bucket, 12 gi bucket, gi mug, road cleaning brush, bill hook, grass cutter with handle, broom stick with handle

Locating Plate Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government And Public Sector

Central Government/Public Sector