Latest lubricant item Tenders | Government lubricant item Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39697186

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of etp chemicals and consumables-, antiscalent chemical for ro membrance (water palnt), antiscaling chemical with ph booster for 5mt boiler dosing, ink cartridges, makeup cartridges, cleaning solution, etp chemicals, hydrochloric acid (hcl), sulphuric acid, lr grade, 05 ltrs pack, k2cr207potassium dichromate er 500 gr pack, ferroin indicator, 100 ml pack, mercuric sulphate,250 gr pack, silver sulphate, 25 gr, petroleum ether,2.5 ltrs , sodium azide 100 gr , manganous sulphate 500 gr , manganoussulphatemonohydratesq 500g, ferric chloride250 gr , calciumchloride250 gr , hcl250 ml , starch500 gr , ferrous sulphate500 gr , whatman filter paper 40 no - 01 no's, whatman filter paper, 41 no-01 no's, normal filter paper 1mx1m- 02 no's (10 sheets), sodium hydroxide pellets250 gr , sodium iodide100 gr , sodium thiosulphate500 gr , kh2p04 (potassium dihydrogen o phosphate) 250 gr, na2hp04sodium phosphate monobasic anhydrous er 250 gr, buffer solution ph 4.0 , buffer solution ph 7.0 550ml , buffer solution ph 9.2 550ml , ferric alum, pac, dap , hypochlorite , urea

Central Government/Public Sector

CTN :39774589

12 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals and consumables - oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 , dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.

State Government

CTN :39797545

26 Mar, 2025 NA

Dapoli - Maharashtra

Tender For quotation for molysol e annual repair-500ml moly--ethanol, petroleum ether 40-60-500 ml, whatman - filter paper no.1 12.5cm 1001-125, borosil -dishes culutre petri, s-li 100x15mm, adenine sulphate 10gm-molychem, tween 80-500ml-molychem, indole-3 butyric acid 25gm molychem, cotton bundle (absorbent) (500 gm) and ethanol annual repair 99.9% -500 mi

Private Sector

CTN :39725493

27 Mar, 2025 NA

Jhajjar - Haryana

Tender For fine chemicals - petroleum ether 60-80 deg. c, chemicals chlorotex reagent, sulphuric acid :(ar/gr/excelr), hydrochloric acid conc. ar/gr, acids:-nitric acid ar, acetone, ammonium molybdate ar/gr/excellar, ansa, ar/gr/excellar,100 gm, chemical: buffer solution of ph-4.00, chemical: buffer solution of ph-7.0, chemical: buffer solution of ph-10.0, potassium hydroxide pellets ar, boric acid ar/gr/excelar, ammonium metavandate ar/gr/excelr, sodium nitrate; ar/gr/excelar grade, sod. meta silicate lab(ar)

CTN :39668047

03 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For tender for purchasing of chemicals in controller food and drug - list of chemicals, acetonitrile, acetic acid, ammonium formate, methanol, formic acid, nitric acid, hydrogen peroxide, magnesium sulphate (anhydrous), hydrochloric acid, c18 cleaning salt, ascorbic acid, primary secondary amine, sodium accetate anhydrous, ammonium formate, ammonium hydrate, tetra butyl ammonium hydride, tetrabutyl ammonium sulphate, methyl chloride, dansyl chrodide solution, green s, ethanol, ammonium phosphate monobasic, acetic acid glacial, methylene chloride, ethyl ether, n-hexane, toluene, ethyl acetate, potassium phosphate monobasic, ortho phosphoric acid, ammonium acetate, sodium sulphate anhydrous, alchohol ethanol, acetic acid glacial, acetone (hplc), aluminium oxide (activated), amonium solution, potassium sulphate, potassium iodide, silver nitrate, alkali blue 6b, boric acid, sodium thiosulphate, eosin 2% (staining solution), calsium chloride, carbon tetrachloride, barium chloride(dihydrate), edta, erichrome black-t, furfural, orthophosphoric acid, glycerol, hydrochloric acid, isopropanol, iso-amyl alchohol, methanol(hplc), nitric acid, petroleum ether 40-60, petroleum ether 60-80, phenolphthalein, potassium permagnate, resourcenol, sucrose, sulphuric acid, tlc plate, hplc water, dyethyle ether, chloroform, amylacitate, fehling sol. a, fehling sol. b, iodine resublimed, sodium hydroxide pellets, cyclohexane, methanol, ammonium chloride, ammonium hydroxide, murxide, pattons and readers, calcium, trifluoro acetic acid, edta disodium salt(dihydrate), name of culture media/serum/ chemical, agar base, baird parker agar base, egg yolk tel emulsion(50ml/100ml per vial), bismuth sulphite agar, bhi broth, brilliiant green bile broth 2%, buffered peptone water, cooked meat medium (rc medium), carbohydrate consumption broth, decarboxylase test medium (falkow), dextrose tryptone agar, fraser broth base, fraser selective supplement, fraser supplement, emb agar, levine, hugh-leifson medium, kligler iron agar, koser citrate medium, lactobacillus mrs agar, lactose broth, lysine iron agar, macconkey agar, motility test medium, mr-vp medium, myp agar base (phenol red egg yolk polymyxin agar base), poly b selective supplement, egg yolk emulsion(50ml/100ml per vial), modified listeria oxford agar base, colcef selective supplement, nitrate broth, nutrient broth, peptone water diluent, plate count agar, listeria identification agar base (palcam), palcam selective supplement, selenite cysteine broth, sheep blood agar base, thiosulphate citrate bile salt sucrose agar(tcbs), triple sugar iron agar, tryptone broth (tryptone water), urea agar base, xylose lysine deoxycholate agar (xld agar), tryptic soy agar, violet red bile agar, perfringens agar base, tsc selective supplement, cmf selective supplement, tryptone glucose extract, thioglycolate agar, tryptone salt agar w/1% nacl, tetrathionate broth base (w/o iodine & bg), potato dextrose agar, phenol red broth base, my 40 (osmophillic agar), acetate agar, czapek yeast (autolysate) agar, 10% lactic acid solution (10 ml/vial), ec broth, gn broth, hajna, hektoen enteric agar, lauryl sulphate broth (lauryl tryptose broth), liver broth / l-broth, modified, malonate broth, malt agar, mannitol salt agar base, glucose agar, yeast extract powder, peptone, rappaport vassilidis medium, saline nutrient agar, alkaline saline peptone water, onpg broth, bolton broth base, bolton selective supplement, violet red bile glucose agar w/o lactose, iron sulphite agar, ellners broth, willis and hobb s medium, glucose of medium, tryptone bile glucuronic agar (tbx agar), tergitol-7-agar base, ttc solution 1% (10ml/vial), macconkey broth, macconkey broth purple, simmons citrate agar, macconkey sorbitol agar, tryptone soya yeast extract broth, hicrome listeria ottaviani agosti agar, oa selective supplement, lp enrichment supplement, mueller kauffman tetrathionate broth base, chromogenic coliform agar, slantz & burtley medium, bile

Central Government/Public Sector

CTN :39697545

04 Apr, 2025 NA

Solapur - Maharashtra

Tender For supply of chemicals - natural colour 10000 ul capacity la888 1 x 100no 1 x 100no , freezing bo x es cardboard dim 13.4 x 13.4 x 4.7cm 64 place freezing bo x 2 inch cg289 1 x 10no 1 x 10no , freeze tag white label size 25 x 13 mm 1000 labels pack roll form la938w 1 x 1000no 1 x 1000no , hiindicator ph paper la310 1pk 1pk , cryogenic permanent marker red dual point la697 1no 1no , cryogenic permanent marker black dual point la697a 1no 1no , hicap b18 blue coloured 18 mm od pw024 500no 1 no , hicap b38 blue coloured 38 mm od pw032 500no 1 no , triclogel in 5 lit can pack co155 1no 1 no , hi pette autopipette stand made with acrylic sheet 9 pipette holding capacity with tip bo x la632 1no 1 no , pikovskayas broth medium granulated gm1719 500g 500gm , aleksandrow broth m1997 500g 500gm , zinc solubilizing medium m2023 500g 500gm , 100bp dna ladder mbt049 200ln 200ln 4 x 200 ul , 2 x pcr taq mi x ture mbt061 100r 100r 2.5 ml , 50 x tae ml016 500ml 2 x 500 ml , syringe driven filters sf144 2 x 50no 2 x 50 no. , syringe driven filters sf143 2 x 50no 2 x 50 no. , petroleum ether 60 to 80 degree c hi ar as065 2.5l 2.5 liter , quantitative filter paper 0740 1250 100c , freeze tag la940w 1 x 1000no , l proline pct0317 25g 25 gm , polygalacturonic acid rm4779 5g 5 gm , orthophosphoric acid abt 88 percent hi ar as011 500ml 500 ml , hydrochloric acid abt 35 percent pure hi ar as004 2.5l 2.5 liter , ferrous ammonium sulphate he x ahydrate hi ar acs grm3887 500g 500 gm , potassium dihydrogen phosphate for hplc grm2951 250g 250 gm , diphenylamine hi ar acs grm520 250g 250 gm , paraffin liquid heavy grm6362 500ml 500 ml , paclobutrazol pct0828 25g 25 gm , buffer solution ph 4.0 plus or minus 0.02 ml061 500ml 500 ml , buffer solution ph 7.0 plus or minus 0.02 ml062 500ml 500 ml , buffer solution ph 9.2 plus or minus 0.02 ml063 500ml 500 ml , starch soluble hi ar acs grm3029 500g 500g , gluten hydrolysate maize rm6406 500g 500g , pectin grm396 500g 500g , guar gum powder grm1233 500g 500g , glycerol 85 percent as100 1l 1l , tween 80 lq520 x 25 x 10ml 25 x 10ml , gelatin type a mb169 500g 500gm , 2 4 6 tri2 pyridyl s triazine rm1487 1g 1 g , ferric chloride anhydrous tc583 5g 5 g , 2 2 diphenyl 1 picrylhydrazyl rm2798 1g 1 g , chitosan from shrimp shells grm9358 100g 100 g , sodium borohydride hi ar acs grm10345 100g 100 g , phenol reagent hi lr rm10822 100ml 100 ml , clear ph buffer solutions 480 ml bottleph 4.01 ecbu4bt 480 ml , clear ph buffer solutions 480 ml bottleph 7.00 ecbu7bt 480 ml , clear ph buffer solutions 480 ml bottleph 9.00 ecbu9bt 480 ml , hiindicator ph paper la335 1pk 1 pk , nutrient broth m002 500g 500 g , potato de x trose broth granulated gm403 500g 500 g , agar powder bacteriological grade grm026p 500g 500 g , autoclavable petri plates pw008 1 x 100no 1 x 100no , freeze tag la939w 1 x 1000no 1 x 1000no , parafilm d m250 la017 1no 1 no , s.s test tube racks la222 1no 1 no , hiclean liquid soap as023 5l 5 l , hidispo bag 14 pw038 250no 250 nos. , syringe driven filters pvdf hydrophilic membrane pore size 0.22 um 25 mm diameter with prefilter non sterile sf130 1 x 250no 1no. , sulfuric acid pure hi ar as016 500ml 500 ml , perchloric acid about 70 percent hi ar acs as013 500ml 500 ml , sodium hydro x ide pellets hi ar acs grm467 500g 500 g , methanol hi ar as059 2.5l 2.5 l , hydrochloric acid abt.35 percent pure hi ar as004 500ml 500 ml , citric acid anhydrous mb174 500g 500 g , amylase from malt grm638 500g 500 g , nutrient agar bid details/ 2 / 103 medium mm012 500g 500 g , potato de x trose agar mh096 500g 500 g , lactobacillus mrs agar mrs agar m641 100g 100 g , phytawrap pla002 1 x 10no 10 no , hi fle x iloop 2 pw012 5 x 100no 5 100no , mueller hinton agar m173 500g 500 g , potassium carbonate anhydrous hi ar grm731 500g 500 g , sodium benzoate hi ar grm1260 500g 500 g , sodium starch glycolate hi lr grm7519 500g 500 g , acetone hi ar as025 500ml 500ml , 0.1 percent peptone water lq172c 5 x 100ml 5 100ml , triclogel dispense

CTN :39572371

26 Mar, 2025 NA

Karnal - Haryana

Tender For supply of science laboratory items - voltmeter , ammeter , galvanometer , stop watch racer , copper wire insulated , copper sulphate , ammonium chloride , leclanche cell complete , daneil cell complete , parallelogram app , prism , optical bench 1 mtr , jockey , zener diode , spring constant app , spherometer , inclined plane app , constantin wire , rubber tube 1mm , mg ribbon , bob for pendulum , wooden scale 100cm , wooden scale 50cm , wire for meter bridge , needles for optical bench , helical springs , pulley set for parellelogram law of forces , potentiometer , meter bridge , sonometer , rehostat long , two way key , one way key , battery eliminator , mirror-concave silver polish , mirror- convex silver polish , mirror strips , lens-convex thick , laser light , electric bell demo , common household circuit , common electronic circuit , torch rechargeable , beakers 100ml , conical flask 125ml , burette 50ml , pipette 10ml , filter paper , ph paper , cobalt nitrate , copper sulphate , disttilled water , lead nitrate , pottassium iodide , starch soluble , cobalt chloride , ammonium bromide , ammonium acetate , sodium hydroxide , lead iodide , litmus paper , iron sulphide sticks , mohrs salt , potassium permgnate , ferric chloride , ferrous sulphate , acetic acid , oxalic acid , ammonia soluion , bromine water , hcl acid , h2so4 acid , nesselers reagent , sodium sulphate , baking soda nahco3 , blue ink , barium chloride , sodium sulphate , potash alum , potassium chromate , potassium dichromate , patassium ferricynide , potassium ferrocynide , wire gauge , clamps for burette stand , weighing machine digital , test tubes , induction cooker , china dish , chromatography paper , coloured charts , beakers 250ml , test tube holders , spatula , droppers , brushes , forceps , scissors , eye piece 10x , objectives 10x , floroglucinol , diphenylamine , silver nitrate , acetocarmine , ammonia molybedate , acetone , petroleum ether , glycerol , nutrient solution pollen g , ethanol , chromatography paper , blades surgical , microscope research , calcium oxide , phenopthalein , methle orange , reagent bottles 250ml , safranine , funnel glass , methylene blue , potassium chloride , sodium chloride , digital weighing machine , prepared slides , pedigree charts autosomal and sex linked , chart homologous and analogous , enzymes cellulase and zipase and pectinase , enzymes protease and ribonuclease , ice box

Lubricant Item Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

State Government

Private Sector

Central Government/Public Sector