Latest medical reagent Tenders | Government medical reagent Tenders

State Government

CTN :39840292

01 Apr, 2025 5.00 Lacs

Nagaur - Rajasthan

Tender For lab reagent

Central Government/Public Sector

CTN :39827493

12 Apr, 2025 NA

Delhi - Delhi

Tender For procurement of lab chemical/kits/reagent fo thesis list of item enclosed with specifications

Co-operative

CTN :39834125

01 Apr, 2025 47.5 Thousand

Gurgaon - Haryana

Tender For supply of lab items - 9002268, 5.000, methylene blue dye1 each contain 25 gmake-qualigen/merck, 9005388, 1.000, acetic acid1 each contain 500mlmake-qualigen/merck, 9002597, 1.000, barium chlorode1 each contain 500 gmmake-qualigen/merck, 9000601, 500.000, reagent strips for milk analysis salttotal qty : 6 each1 each - 100 stripsmake- delmos researchreagent strips for milk analysis neutralizertotal qty : 6 each1 each - 100 stripsmake- delmos researchreagent strips for milk analysis starchtotal qty : 6 each1 each - 100 stripsmake- delmos researchtotal 18 each , in which 6 ea-salt , 6 ea-neutralizer & 6 ea-starchkindly supply new manufactured stock and check the expiry date before supplying., 9002268, 20.000, chloroform1 each contain 500mlmake-qualigen/merck, 9002640, 4.000, phenol red1 each contain 25 mlmake-qualigen/merck, 9001787, 500.000

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39804397

31 Mar, 2025 NA

Ponnani - Kerala

Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

CTN :39322122

28 Mar, 2025 NA

Bhopal - Madhya Pradesh

Tender For bid to ras corrigendum : procurment of lab reagents - cled agar , kit for estimation of cpk , prothrombin time reagents , pttk reagent , occult blood test , d dimer ichroma , kit for estimation of cpk-mb , pt reagent , biofix cytofix spray , pa colifrom kit , snap pack for eletrolyte analyser , kit for csf microprotien , transasia erba h360 control , transasia erba h360 calibrator , transasia erba h360 elit h clean , transasia erba h360 lyse , transasia erba h360 dil , haematology 5 part h560 lyse 1 , haematology 5 part h560 lyse 2 , heamatology 5 part h560 diluent 1 , transasia erba h560 control , combi disk gn1 abst , combi disk gn2 abst , combi disk gp1 abst , erba wash kit , uristix albumin and glucose , surgical spirit , band aid , kit for lipase , microscope lens cleaning solution , haematoxylin and eosin stain , pencil marking glass , hba1c fully automated em 200 xl system pack , ckmb fully automated em 200 xl system , anti hev , ldh fully automated em 200 xl system pack , ada fully automated em 200 xl system pack , erba norm kit fully automated em 200 xl system pack , erba path kit fully automated em 200 xl system , xl multical fully automated em 200 xl system pack , mac conkey broth powder , micro albumin , micro protein , cytochrome stain kit , erba auto wash , erba auto wash fully automated , anti hav

CTN :39786118

26 Mar, 2025 95.00 Lacs

Phalodi - Rajasthan

Tender For corrigendum : e tender for lab items - drabkin solution for hb estimation, tlc dilueting fluid, tlc pipette, dlc diluting fluid, dlc pipette, platelate count fluid, esr pipette disposable, anti a sera, anti b sera, anti d sera ( igg & igm), anti human globulin ( coombs reagent), normal saline, test tube glass 12 x75, test tube glass 12x100, droper plastic, slide pkt iso mark, cover slips 18x18, giemsa stain, leishman stain, paraffin oil, slide tray aluminum, distilled water, methanol, reticulocyte count fluid, methylene blue soln, brilliant cresyl blue soln, eosinophill count fluid, hemocytometer ( counting chamber ), bt ct capillary, filter paper, stop watch/timer, alcohol swabs, sickling test for sickle cell anemia, sickling rapid test for sickle cell anemia, nestroft test for screening of thalessemia, dcip for screening for hbe hemoglobinopathy, quantitative test g6pd deficiency, malaria rapid card test, pt reagent, sodium citrate tube for pt test, aptt reagent, calcium chloride soln, hcg ( pregnancy card), urine strips for ph,sg,tlc,glu,bil,uro,ketone,protein,nitrate, urine container plastic 30ml, test tube disposable plastic 12x100 ( 4 " ), urine strips for microalbumin, urine strips for acr, test kit for stool for ova and cyst, test kit for occult blood, semen diluting fluid, dengue rapid card test (igg,igm & ns1 ag combo), typhoid card test antibody, rpr /vdrl test for syphilis ( rapid card tests), rapid test card for the simultaneous detection of malara pv/pf antigen, s.thphi ( igm antibodies) and dengue ns1 antigen from a single card ( combo), hiv rapid card test with single step procedure ( serum and plasma), hbsag rapid card test 0.1 iu/ml senstivity, anti hcv rapid card test, rapid test card for the simultaneous detection of hiv 1& 2,hcv,hbsag ,syphilis from a single card ( combo), afb stain kit, widal test kit, blood sugar kit, gtt test kit, bilirubin total & direct kit, creatinine kit, urea test kit, uric acid test kit, sgpt test kit, sgot test kit, alkanine phosphate test kit, total protein test kit, albumin test kit, globulin test kit, total cholesterol test kit, triglycerides test kit, vldl direct test kit, hdl direct test kit, ggt test kit, amylase test kit, iron test kit, tibc test kit, hba1c test kit, s.calcium kit, s.magnesium test kit, acid phosphatest test kit, grams stain soln, thorat swap for diphitheria, visual inspection acetic acid, rk 39 for kala azar by rapid card test, smear for filaria, montex test 5tu, montex test 10tu, tuberculin syring for montex test, troponin i rapid card test, trop t rapid card test, ra quantitative test kit, crp quantitative test kit, aso quantitative test kit, blue tips, clot activator non vaccum tube double cap, edta nonvaccum tube double cap, jsb stain 1, jsb stain 2, keto stix, lugol iodine, methanol 5ltr, microscope bulb, printer paper roll 57mmx10mtr, printer paper roll 57mmx20mtr, sodium citrate soln, sodium hypochlorite soln, tissue paper roll, urine strips 04 parameter, yellow tips, electrolyte analyzer as per enclsoed technical specifications, 5 part hematology analyzer as per enclosed technical specifications, fully automated immunoassay analyzer ( clia) as per enclosed technical specifications, semi automated bioschemistry analyzer as per enclosed technical specifications

State Government

CTN :39809715

03 Apr, 2025 NA

Papumpare - Arunachal Pradesh

Tender For supply of quality control lab equipments - digital weighing machine 2 kg , electronic portable balance 50 gms , enamel plate , parkhi , sample divider , scoop set , measuring cylinder 500 ml , measuring cylinder 25 ml , magnifying glass , pipette , test tube with stopper , gas mask , seive set , conical flask , grain dial calipers , measuring flask , rice broken separator , reagent bottle

State Government

CTN :39798799

26 Mar, 2025 4.75 Lacs

Chittorgarh - Rajasthan

Tender For supply of lab reagents- hb (strip) , tlc , dlc , platelet count , cbc (reagent) , esr , aborh (antien) , pbf , reticulocyte count , absolute eosinophil count , bt & ct (micro capillary tube, tissue paper) , sickling test for sickle cell anema , qunatitative test g6pd defi-ciency , mp slide / malaria rapid test , pt , aptt , urine for hcg , urine test for ph, sg, tlc, ? glu, bil, uro, ketone, pro-tin, nitrite , urine microscopy (micro scopy cover glass) , urine microalbumin , 1 urine for acr , , 24 hour urinary protien , stool for ova and cyst , stool for occult blood , test for dengue (rapid card test) , rpr/vdrl test for s philis (ra id test) , hiv 1+2 test (rapid test) , hbsag (rapid test) , anti hcv (rapid test) , sputum for afb (tishu pa-per) , typhoib test igm/widal , blood sugar , gtt , bil-total , bil-direct & indirect , s-creatine , b urea , uric acid , sgpt , sgot , alkp04 , total protein , albumin and ag ratio , total cholestrol , s.tg , s.vldl , s.hdl , s.ldl , s.na , s.k , s.cal , acid phosphate , smear for rti/std , gram staining for clinical specimen , thorat swap for diphttheria , visual inspection acetic acid , rk 39 for kala azar rapid card test , smear for filaria , tb-mantoux , ra quantitative , crp quantitative , aslo quantitative , tsh , urine for c/s , pap sow , koh mount for fungal test , semi auto analyzer , urine analyzer 11 parameter

Medical Reagent Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Co-operative

State Government

Central Government/Public Sector

State Government

State Government