Latest medicine Tenders | Government medicine Tenders

State Government

CTN :39834913

07 Apr, 2025 NA

Gurgaon - Haryana

Tender For supply of acetonitrile lcms grade , psa spe suitable , c18 spe suitable , magnesium sulfate anhydrous acs , phosphate buffer saline , sodium acetate anhydrous acs grade

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39835468

16 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of hepatitis b vaccine , inj insulin mixtard 50 per 50 vial of 10ml , keto diastix bott of 50 strips , oint acyclovir , syp iron 200 ml , glucose saline isotonic solution bottle of 500 ml , inhaler beclomethasone dipropionate 50 mcg per dose metered dose 150 units , oint antiphelebitis tube of 15g per 20 g , rotacaps formeterol budesonide rotacaps 100 mcg , tab fenofibrate 200 mg , tab cilostazole 100mg , tab amlodipine 2 point 5 mg , tab bisoprolol 5 mg

CTN :39835530

15 Apr, 2025 NA

Ambala - Haryana

Tender For supply of medicine - disposable skin biopsy punches size 5 mm , disposable skin biopsy punches size 6 mm , 50 percent glycolic acid peel 60ml with pre peel liposomal cleanser 250 ml and peel neutralizer 250ml kit ph 1 point 0 , hydrocortisone acetate cream 1 percent ww tube of 15 gm , azelaic acid 20 percent cream tube of 15 gm , cream eberconazole 1 percent tube of 60gm , mometasone lotionion 0 point 1 percent tube of 15 ml , tofacitinib 2 percent cream tube of 30 gm , cap minocycline er 65 mg , minoxidil 5 percent wv plus finasteride 0 point 1 percent wv lipid solution 60 ml , methotrexate lp liposomal topical gel 1 percent tube 20 gm , 0 point 04 percent tretinoin microsphere gel tube of 15 gm , self adhesive silicon gel sheet 10cm x 10 cm , tretinoin gel 0 point 025 percent tube of 20 gram , 0 point 1 percent triamcinolone acetonide bucccal parts 7 point 5 gm tube , tab bilastine 10 mg , hydrous benzoyl peroxide ip benzoyl peroxide face wassh 4 percent of 50 gm , ung kojic acid 3 percent vit c 15gm , white soft paraffin light liquid paraffin light liquid paraffin dermoy cream of 50 gram , tab fluconazole 400mg , aloe vera 10 percent with vit e 0 point 5 percent in 10 percent natural moisturising base lotionion 50ml , lotion minoxidil 10 percent bott of 120 ml , sterile wound dressing pad pack of 50 size 7 point 2 x 5 cm , white soft parrafin 13 point 2 percent liquid paraffin 10 point 2 percent cream 50 gm , lotion clotrimazole 1 percent plus beclomethasone 0 point 025 percent bott of 15 ml , disposable miniature punches size 3 mm , disposable miniature punches size 4 mm , 15v 150w halogen lamp for kari kaps surgical microscope som62 advance

CTN :39835552

09 Apr, 2025 NA

Palanpur - Gujarat

Tender For supply of stop watch,starting block training,hurdles training,relay baton,take of board,shot put 2 kg,shot put3 kg,shotput 4 kg,discus 750 gm,discus 1 kg,discus 1 25 kg,discus 1 5 kg,rubber discus 750 gm,rubber discus1 kg,rubber discus 1 25 kg,rubber discus 1 5 kg,javelin 400gm,javekin 500gm,javelin 600gm,javelin wooden 400gm,javelin wooden 500gm,javelin wooden 600gm,kids javelin,measure tape 30 mtr,measure tape50 mtr,medicine ball 1 kg,medicine ball 2 kg,medicine ball 3 kg,sprint suite,low hurdles,low hurdles 9 inch,low hurdles 12 inch,cones 6 inch,cones 9 inch,cones 12 inch,spot markers,agility ladder,swiss ball,plyomatrix box wooden,bosu ball,abs roller,wooden bow set weith stabilizer,wooden arrow,wooden arrow shaft,point,nock,spin vanes,arrow rest,target butress,taret stand,target face pin,target face 122 cm,target face 80 cm,servingmaterial,string material

Central Government/Public Sector

CTN :39837161

02 Apr, 2025 NA

Ahmedabad - Gujarat

Tender For supply of dextrose 5percent in normal saline 540 or 500ml infusion ]

corporations/Associations/Others

CTN :39490168

29 Mar, 2025 17.00 Lacs

Ahmedabad - Gujarat

Tender For bid to ras supply of medical journals - journals of anatomy , journals of physiology , journals of biochemistry , journals of pathology , journals of microbiology , journals of pharmacology , journals of community medicine , journals of meu

Central Government/Public Sector

CTN :39490269

14 Apr, 2025 NA

Mumbai - Maharashtra

Tender For corrigendum : custom bid for services - hiring of o and m services for 3 years for the low saline water plant installed at the new water injection south r wis r platform complex-ongc intends to hire services for comprehensive operation and maintenance (o&m) of complete low saline water reverse osmosis plant (125,000 bwpd) at mumbai high offshore wis-r platform (approx. 150 km away from shore) through skilled technical manpower to be deployed by the contractor. to provide uninterrupted operation and system availability, the contractor shall offer for comprehensive operation and maintenance of low saline water reverse osmosis plant (lswro pant) the design capacity of the low saline ro plant is 125,000 bwpd (approx. 830 m 3 /hr) of net treated water production on continuous basis with a maximum salinity of 8000 mg/l. the primary feed stream to the desalination plant shall be filtered seawater which shall be made available at the battery limit of the lswro plant at a pressure of 5 bar. treatment scheme and facilities the major components present in the low salinity water package are: 1. swro feed pumps 2. ultra-filtration system 3. uf backwash & ceb system 4. swro feed pumps 5. sea water reverse osmosis system (swro) 6. energy recovery system and booster pumps 7. swro permeate/treated water storage tank and transfer pumps 8. uf & swro cip and chemical handling system

CTN :39585193

29 Mar, 2025 3.39 Lacs

Ambala - Haryana

Tender For bid to ras supply of medicine - tab soft gelatin capsules of gamma tocotrienol and delta tocotrienol isomers derived from tocotrienol rich fractions 400mg , cap antioxidant xeaxanthin lutein and omega 3 fatty acid , collagen peptide 10mg tab , collagen peptide type 2 10 mg plus glucosamine sulphate 1 point 5gm , tab nortryptilin 10 mg , tab thiocolchiciside 8 mg plus acelcofenaic 100mg plus paracetamol 325 mg

Medicine Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

Central Government/Public Sector

corporations/Associations/Others

Central Government/Public Sector