Latest medicines scrap Tenders | Government medicines scrap Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39835468

16 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of hepatitis b vaccine , inj insulin mixtard 50 per 50 vial of 10ml , keto diastix bott of 50 strips , oint acyclovir , syp iron 200 ml , glucose saline isotonic solution bottle of 500 ml , inhaler beclomethasone dipropionate 50 mcg per dose metered dose 150 units , oint antiphelebitis tube of 15g per 20 g , rotacaps formeterol budesonide rotacaps 100 mcg , tab fenofibrate 200 mg , tab cilostazole 100mg , tab amlodipine 2 point 5 mg , tab bisoprolol 5 mg

Central Government/Public Sector

CTN :39825536

07 Apr, 2025 NA

Pondicherry - Pondicherry

Tender For purchase of o.sml micro tube rack , odc mini cooler (blood collection tube) , odc mini cooler (thermo conductive rack) (ino/pk) , odc mini cooler lsml , 1 % dithiothreitol (dtt)-1 g , 1 % dithiothreitol (dtt)-sg , i.sml float rack- 8 places , 1 dc cooler (capacity 1 or 1.8) , 10ml syringe with needle , 10ml syringe with needle (22xl 1f4) , isml centrifuge tube (soo noslpk) sterile , isml centrifuge tube amber conical bottom , 18g needle , lxphosphate buffered saline ca& mg free (sooml) , ix tris edta- ph-7.0 , 2ml screw cap micro tube conical bottom , 20ml syringe , 2ltr plastic beaker , 3% hydrogen peroxide solution , soml centrifuge tube (soonos/pk) , soml centrifuge tube (soonos/pk) racked sterile , soml centrifuge tube large volume wire racks , soml vacuum filter/storage bottle system (12nos/pk) , 8 channel multi pipette (variable) increment 1 ".d with digital , display , 8 channel multi pipette (variable) increment 11-11 with digital , display , 8 channel multi pipette (variable) increment 11-11 with digital , display , a 72s0: n-acetyl-l-cysteine (1 ogm) , absolute alcohol-sooml , absorbent cotton roll , acetic acid glacial , aluminum foil , aluminum weighing boat (100nos/pk) , amber narrow mouth bottle 30ml , amber narrow mouth bottle 8ml (72nos/pk) , antiseptic urinary towelette , apron (white lab coat) full (medium) , apron (white lab coat) full (small) , apron (white lab coat) half sleeve (medium) , apron (white lab coat) half sleeve (small) , ast 2 tube carrier set, (pack of 3) , ast 5 tube carrier set, (pack of3) , ast carrier rack 8 set , ast carrier set -5 tube , auto clave label , autoclavable biohazard bags or specimen l2x24 inches (100 , nos/pk) , autoclavable biohazard bags or specimen 19x24 inches (100 , nos/pk) , bd serum vacutainer-4ml , bd serum vacutainer-6ml , bd vacutainer edta tube-4ml (cbc and hbaic) , bd vacutainer trace element plastic (100/pk) , bd vacutainer k2 edta trace element plastic (loo/pk) , bd vacutainer k2 edta plus 6m! (100/pk) , bd vacutainer safety lock blood collection sets, 21g, , 23gx3/4"xi2 (0.8xi9mmx305mm) (50nos) , bd vacutainer safety lock blood collection sets, 23g, , 23gx3/4"xi2 (0.6xi9mmx305mm) (50nos) , beaker 1000ml (20 per case) , beaker 100ml (20 per case) , beaker 500ml (40 per case) , biohazard waste container- 5ltr , blotting paper sheet , bottle with screw cap 1000m! , bottle with screw cap 500ml , bottle with screw cap 100ml , bottle with screw cap 50ml , bp handle- long & medium , carbol fuchsin (zn, strong) , carbol fuchsin practical grade , card board cryo box 36 places for 15m! centrifuge tubes , (8nos/pk) , card board cryo box 81 places for im1l2ml vials (8nos/pk) , card board cryo box 100 places for iml/2ml vials (8noslpk) , card board cryo box 25 places for 1 m1l2ml vials (8nos/pk) , cedarwood oil , cello chiller box (3l, 8l, 12l, 14l, 20l) (without tap) , champ autoclavable variable volume pipettor (20-200ml) , chromotrope 2r , collapsible space saver rack (2 nos/pk) , combilok (4 nos/pk) , conical centrifuge tube rack (l/pack) , conical flask 100 ml , conical flask 150 ml , conical flask 250 ml , conical flask 50 ml , conical flask 500 ml , coup lin jar places-1 0 , corning 2ml external threaded polypropylene cryogenic vial , self- standing with round bottom (500/pk) , cover slip, rectangular- 22mrnx40mm , cover slip, square- 22mmx22mm , cryo apron 42" , cryo cube box 100 places (4nos/pk) , cryo cube box 25 places (8nos/pk) , cryo cube box 50 places (8nos/pk) , cryo cube box 81 places (4nos/ pk) , cryo cube box 81 places (4noslpk) , cryo gloves (medium) , cryo label nitro tag , cryo laser babies (1.28xo.50mm) , cryo marker , cryopure tubes, 2ml white, internal thread , cryo racks, (50 place) , cryo tags (l.50xo.75) , cryo vials 1.8-2ml (500nos /pk) (self-standing with external , thread) , cryo vials 1.8-2ml (500nos /pk) (self-standing with internal , thread) , cryogenic barcode label l "x 1 " , cryogenic permanent marker blue , cryo vials 1.oml, sta

Central Government/Public Sector

CTN :39825553

07 Apr, 2025 NA

Pondicherry - Pondicherry

Tender For purchase of 5ml micro tahe rack , 8 c mini cooler (blood collection tube , oc mini coolm (tuono conductive rack) (norpk) , c mini coo15ml , 1% dahlodrett (dtt)-10 , in duhinthrenol (dtt)-sg , 1.5m float rack-places , 1 c cool (capacity 1 or 1.3) , uni syringe with naalle , 10ml syringe with noodle (22x1 m) , 15ml centrifuge tabe (500 nos/pk) sterile , 15nt centrifuge tube amber conical bonom , 180 needle , isphosphate buffered saline cad mg five (500ml) , is tris edta-p1e-70 , 2ml screw cap miens tube cotizal bettem , 20ml syringe , lur plastic beska , 7% hydrogen peroxide solution , 50mi centrifuge tube (3000nos/pk) , that cerartflage tube (500nos/pk) hacked sterile , somi cerifuge the large volume wire racks , silmi varaum filter surage bottle symom (12es/pk) , chamel multi pipette (variable) lassement iul with digital display , & channel multi pipetta (variable) lerument iui with digital doplay , channel multi pipata (variable) irement il with digital display , a7250: n-acetyl-l-cysteine (10gm) , absolute alchol-500ml , absorbem cotton rod , annual repairstic acid glacial , alaninum foil , aluminum weighing boat (100nes/pk) , ainbet narrow mouth bottle 30ml , anber narrow mouth botile and (72 ) , antiseptic urinary towalette , aprom (white lab cost) fall (medium , apton (white lab cont) full (small) , apmm (white lab cout) half sleeve (medium) , apron (white lab coat) half sleeve (small) , ast 2 tube carrier set, (pack of 3) , ant 3 tube canter set, (phuck of 3) , ast carrier back , ast carrier -5 the , aute clave label , autoclavable bishanand bugs or specimen 12x24 inches 1100 , nos pk , autoclavable bioltazard hags or specimen 19x24 inchen (100 npk , bd serum vaztainer-m , bd serim vac tal- , bd vastainer edta then (cbc and hhaic) , bd vacutame trace element plastic (100/p) , bd vastaine k2 edta trace element planic (100/7) , bd vinstainer k2 edta plus mi (100/pk) , bd vacutainer safety lock blood collection sets, 210, 23034x12 (0.8x19mmx305man) (2000) , bd vazunaliser safity lock blood collection sets, 230, 2301/12 (0.619mmx305mm) (500) , benker 1000ml (20 per come) , beaker 100ml (20) , beaker 500ml (40 per ome) , biohamand waste comteiner-5ltr , bloning papo shest , battle with screw 1000ml , bottle with screw cap 100 , bottle with screw 100ml , bottle with screw cap 50ml , bp handle long & malim , carti fuchsis (zn, seong) , cartsil fochoin practical grade , card board cryo box 36 places for 15ml cexifage tabes (nos/pk) , card board crye bux 81 places for inilmi vials (nos/) card board cryo box 100 places for imd/2ml vials (nou/pk) , cand beard cryo box 25 man for ind/2mi vials (8nos/pk) , cedarwood nil , cello chiller box (1, 81, 121, 141, 20) (with) , champ autoclavable vurishiz sulume pipettit (20-200m) , chromotrope 2 , collapsille space saver nick (2 nos/pk) , combilok (4 nou/pk) , canina emiflage tube rack (pack) , conical flask 100 ml , comical flask 150 mi , comical flask 250 mi , conical fleek 50 mi , conical flask 500 ml , couplin jar places-10 , corsing 2mi external threaded palypropylese cryogenic vial self standing with round bottom (500/pk) , cover slip restmguir-22mmx40mm , cover slip, square-22mmx12mm , cryo apron 42" , crye cube box 100 placas (4ncs/pk) , crye cuhe box 25 places (en) , crye cube box 50 places (nou/pk) , cryo cute box 81 places (4nos pk) , crye cube box #1 places (4nos/) , crye gloves (medium) , cryo label nitro tag , cryo laser hables (1.20x0.50mm) , cyo marker , cryopure tubes, 2mi white, intersal thenad , cryo racks, (50 place) , cye tags (1.30x0.75) , crye visis 1.8-2ml (100k) (cling with extrsal thread) , cryo vials 1.8-2ml (300nos/pk) (self-standing with interma thread , cryogenic baroode label 1"x1" , cryogenic permanent marker hue , cryo vials 1.0ml, sur foot (500nos/p , cryo vials 1.8ml, ste foot, external thread(300n/pk) , cryo vials 18ml, star foot, internal thread(1000nos/pk) , cryo vials 1.8 (star foot, internal thread) (500nos/pk) , cutarab , dp.x. manastast (la

Central Government/Public Sector

CTN :39826384

22 Apr, 2025 NA

Dibrugarh - Assam

Tender For tender for supply of surgical and consumables hospital furniture etc to assam medical college hospital dibrugarh - supply of surgicals, consumables and hospital furniture, absolute alcohol, absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip 300gm roll, adhesive tape 7.5cm x 5 mtr spool, alcohol swab, aldheyde free disinfectant, anti septic solution 1000 ml, bandage 90cm x 18mtrs,, betadin ointment tube/nanz/ collapsible tube, betadin solution 500ml (5%), bleaching powder, cannula fixer, cidex solution 2.45% 1000 ml, collagen sheets 10 x 10cm, cotton crepe bandage b.p. size: 4mtr x 6 cm, cotton roll 500gm, disinfection solution 5 ltrs jar, elastic adhesive bandage 10cm x 1mtr, formalin, gauge cloth 90cm x 18mtr, gauge swab non sterilized, gauge swab sterilized, glycerol, hand sanitizer, hand wash 500ml bottle/, hydrogen peroxide, hypoallergenic non-woven tape, size: 5m x 2.5cm, hypoallergenic non-woven tape, size: 5m x 5cm, lysol, mackintosh sheet, methylated spirit 1 ltr jar, micro-porous plaster size: small/each box, micro-porous plaster size: big/each box, paper adhesive size: 1" x 9.0 mts, paraffin gauge dressing b.p. size: 10cm x 10cm, phenyl 450 ml bottle, phenyl solid, plaster of paris bandages bp size: 15cm x 2.7 mts, plaster of paris bandages bp size: 10cm x 2.7 mts, raxin sheet, rectified spirit 450ml, roll bandage 10cm x 5mtrs, rolled bandage 5cm x 5mtrs, 100gm/doz, rolled bandage 5cm x 5mtrs, 60gm/doz, savlon, senitary napkin, sodalime 5kg jar, surgical gauge pad, back rest, bed side screen 4 fold, biomedical waste bin trolley, door screen white, size: 200cm x 114cm/, dressing trolley, dressing trolley big size, ecg trolley, foot step (double step), foot step (single step), fowler bed (deluxe), hygiene trolley, icu bed (fowler), icu bed (mannual), icu bed with remort control, instrument trolley, instrumet cabinet, medicine cabinet, medicine trolley, mosquito stand, orthopedic bed, oxygen cylinder carrying trolley, oxygen cylinder trolley (d-type) 140cm hight tubular ms frame work fitted with wheel 125mm dia., patient carrying trolley, patient examination bed, patient examination couch, patient examination table, pediatric bed, revolving stool, revolving stool ss, saline warmer, semi fowler bed, semi fowler bed (super) with mosquito net stand, sevotec veporiser, stretcher, stretcher on trolley, waiting chair (regular), ward bed (general), wheel chair, mosquito artery forceps, speculam, pvc pipe for central line, reservior bag for anaesthesia machine, anathesia face mask 0,1,,2,3, black rubber mask 1,2,3,4, uterine sound, towel clip, ecg paper for schiller machine model at2 per packet, ecg paper for edan machine per packet, laryngeal mask airway size 1,1.5,2,2.5, i gel size 1,1.5,2,2.5, bowl stand, sterlized drum trolley, volcellum, post vaginal well retractor, cup t removal hook, anti vaginal well retractor, cunalty, coscors self retractor, angle lip retractor, hegari dilator, theraputic paraffin wax, absolute alcohol (denaturated alcohol), absorbable gelatine sponge ip 66 80mm x 50mm x 10mm, absorbent cotton wool ip, 300 gm roll, adhesive tape, 7.5cm x5mtr spool, alcohol swab, aldheyde free disinfectant, all container vial ( non vaccum, non iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, etc., all container vial (vacuum, iradidiated), clot. activitor, b cit 3.2%, glucose, edta, esr, z no add, k2, k3, allies tissue forceps, size: 6 , 8 , autoclave big, size:big, autoclave, size: medium, autoclave, size:small, b.p. bulb, b.p. handle stainless steel, size: 3, b.p. handle stainless steel, size: 4, bandage cloth, size:90cm x 18mtrs, 325gm, barium sulphate 5 kg jar, bed pan, betadin solution 500ml (5%), bleaching powder, blood administration set disposable sterilized, bp blade, size: 11,15,20,21,22,23,24, bp instrument stand type, bp instrument (mercurial) table model, b.p instrument (digital), cannula (3 way), cap (disposable), carbon di oxide b-type cylinder (as per latest iso s

CTN :39334759

27 Mar, 2025 NA

Mumbai - Maharashtra

Tender For bid to ras tender for supply of inj adrenaline 1ml , inj anti d immunoglobulin 300 mcg , inj atropine sulphate 1ml , inj bupivacaine hcl in dextrose injection 4ml , inj bupivacaine 20ml , inj calcium gluconate 10ml , inj caffeine citrate 3ml , inj cefotaxime sodium 1gm , inj ceftriaxone sodium 1gm , inj colistimethate sodium 1miu , inj diclofenac sodium 75mg 3ml , inj dopamine 200mg 5ml , inj dexmeditomidine 50mcg , iv dextrose 5percent w per v 500ml , iv dextrose 10percent w per v 500ml , iv dextrose with normal saline w per v 500ml , inj frusemide 2ml , inj fentanyl citrate 50mcg 2ml , iv fluconazole 100ml , inj glycopyrolate 1ml , iv multiple electrolytes and dextrose inj 500ml , inj iron sucrose 2 point 5ml , inj lignocaine hcl plain 2percent w per v 30ml , inj lignocaine with adrenaline 30ml , inj menadione sodium 1ml vitk , inj methyl ergometrine 0 point 2 mg per ml , iv normal saline 500ml , iv normal saline 100ml , inj neostigmine 1ml , inj paracetamol iv use , iv paracetamol 100ml , inj pentazocin lactate 1ml , inj potassium chloride 10ml , inj promethazine 2ml , inj propofol 1percent w per v , iv ringer lactate 500ml , iv linezolid 300ml , tab amox plus clav 625 mg , tab ascorbic acid 500mg , tab b complex therapeutic , tab calcium plus vitamin d3 500mg , tab cefixime 200mg , tab folic acid 5mg , tab metromidazole 400mg , tab labetolol 100mg , cap amoxycillin 500mg , cap doxycylive 100mg , cap ferrous sulphate plus folic acid , syp albendazole 10ml , syp amox plus clav 125 mg 60ml , syp calcium plus vitamin d3 , povidone iodine 5percent solution 500ml , bandage cloth 100cmx20mtr , absorbent gauze 90cm x 18mtr , disposable non traumatic razor , disposable spinal l p needle 23g , disposable spinal l p needle 25g , disposable urine collection bag , ecg lead electrodeadult , elastic adhesive bandge 10cm x 4mtr , infant feeding tube no point 7 straight , infant feeding tube no point 8 straight , gelatin sponge , nasal oxygen cannula neonatal size 00 , umbilical cord clamp , chromic catgul size 1 nw 4227 , chromic catgul size 0 nw 4242 , ethilon size 2 point 0 reverse cutting nw 3336 , monocryl size 3 point 0 w 3326 , vicryl no point 1 nw 2347 , prolene mesh 15cm x 15cm , sodium hypochloride solution 46percent 5litre , proctolysis enema , sevoflorane 250ml for inhalation , inj lung surfactant 4ml

CTN :39385046

26 Mar, 2025 NA

Patiala - Punjab

Tender For bid to ras bid to ras supply of gliclazide 30 mg mr tab , glimepride 1 mg plus metformin 500 mg tab , glucosamine 500 mg plus diacerin 50 mg tab , glutamine sachet , glutathione 500 mg tab , glycerin ip bott of 100ml , glyceryl nitrate 6.4 nitrocontin tab , haloperidol 5mg tab , heparin 15g 20g oint , hydralazine 37.5 plus isisorbide dinitrate 20 mg tab isolazine , hydrochlorothiazide 12.5 mg tab , hydrochlorothiazide 25 mg tab , hydrocortisone 10 mg tab , hydrogen peroxyde solution , hydroxyurea 500 mg cap , hydroxyzine 10 mg tab , hydroxyzine 25 mg tab , ibuprofen 100mg 5mg bott of 50 ml syp , imatinib mesylate 100mg tab , imipramine 25 mg tab , inh triohale tiotropium bromide 9 mcg plusformoterol 6 mg plus ciclesonide 200mcg 200 meter dose inh , inj pheniramine 22.75 mg ml , inj dexamethasone 2 ml vial , inj diclofenac 25mg ml 3ml voveran , inj dicyclomine 20 mg , inj drotaverine , inj erythropoietin recombinant human 2000 iu , inj etophyllne 84.7 plus theophylline 25.3 ml , inj frusemide ip 20 mg ml , inj levocarnitine 500 mg , inj methylcobalamin 1000mcg plus vitamin b6 pyridoxine 100mg plus nicotinamide 100mg neurobion , inj methylcobalamin 1500 mcg , inj metoclopramide 5mg ml , inj nandrolone decanoate 25mg ml , inj normal saline 100 ml , inj tt tetanus toxoid 5 ml , isosorbid mononitrate 10 mg tab , isosorbide dinitrate 10 mg tab , isotretinoin 20 mg tab , ketorolac 10 mg tab , l- ornithine l asparate powder 5gm , labetalol 100mg tab , lacosamide 50 mg tab

CTN :39776689

28 Mar, 2025 1.83 Lacs

Tiptur - Karnataka

Tender For supply of drugs, chemicals and consumables to gh tiptur - ferrous salts (a) +folic acid (b) 20mg elemental iron (a) +100mcg (b)20 mg + 100 mcg ip/bp/usp(1x10x10) _tipturgh, adrenaline bitartrate1mg/ml injection_tipturgh, amikacin500mg/2ml injection_tipturgh, amitriptyline25mg (1x10x10)_tipturgh, amoxicillin+clavulinic acid625mg(1x10x10)_tipturgh, amoxicillin+clavulinic acid 200mg+28.5mg/5ml drysyrupx 30ml_tipturgh, amoxycillin powder 125mg/5mldrysyrupx60ml_tipturgh, amoxycillin powder 250mg/5mldrysyrupx60ml_tipturgh, anti-d immunoglobin (human)300mcg injection_tipturgh, antisnake venom (polyvalent lyophilized)_tipturgh, atenolol50mg(1x10x10)_tipturgh, atorvastatin100mg(1x10x10)_tipturgh, atropine sulphate1mg/ml injection 1ml_tipturgh, calcium carbonate with vitamin d3500mg+250iu (1x10x10)_tipturgh, cefotaxime1 gm ip/bp/usp injection_tipturgh, ciprofloxacin hydrochloride500mg(1x10x10)_tipturgh, ciprofloxacin hydrochloride eye/ear0.3%w/v x 5ml eyedrop_tipturgh, dexamethasone4mg/mlinjection 2ml_tipturgh, dextrose5%w/v infusion x 500ml_tipturgh, dextrose with sodium chloride5% + 0.9% w/v x 500ml infusion_tipturgh, diclofenac25mg/ml injection 1ml_tipturgh, diclofenac25mg/ml injection 3ml_tipturgh, dicyclomine hydrochloride10mg/ml injection_tipturgh, diptheria and tetanus vaccine .5ml injection_tipturgh, dopamine hydrochloride40mg/ml5ml injection_tipturgh, frusemide10mg/ml x 2ml injection 1x2ml_tipturgh, glimepiride2mg(1x10x10)_tipturgh, glyceryl trinitrate (sublingual)0.5mg(1x10x10)_tipturgh, hydrocortisone sodium succinate100mginjection5ml_tipturgh, iron sucrose 100mg/5ml injection 1x5ml_tipturgh, ketamine hydrochloride10mg/mlinjectio x10ml _tipturgh, labetolol100mg(1x10x10)_tipturgh, labetolol5mg/ml injection5ml_tipturgh, levo cetrizine5mg (1x10x10)_tipturgh, lignocaine hydrochloride with adrenalin(1x30ml)2% w/v+.001%w/v injectionx30ml_tipturgh, lignocaine hydrochloride(1x30ml)2% w/v injectionx30ml_tipturgh, magnesium sulphate500mg/mlinjection1x2ml_tipturgh, mannitol20% x100ml infusion_tipturgh, metronidazole400mg (1x10x10)_tipturgh, metronidazole500mg/100ml infusion x100ml_tipturgh, metronidazole200mg/5mlsyrup 60ml_tipturgh, misoprostol200mcg(1x10x10)_tipturgh, ondansetron2mg/mlinjectionx2ml_tipturgh, oral rehydration saltssodium cloride 2.6,glucose anhydrous 13.5,potassium cloride 1.5,trisodium citrate dihydrate 2.9 powder 10gm sachet_tipturgh, oseltamavir75mg(1x10x10)_tipturgh, oseltamavir12mg/mlsyrupx100ml_tipturgh, oxytocin5iu/mlinjection x1ml_tipturgh, omeprazole capsules 20mg(1x10x10)_tipturgh, paracetamol500mg(1x10x10)_tipturgh, paracetamol650mg(1x10x10)_tipturgh, paracetamol125mg/5mlsyrup x60ml_tipturgh, paracetamol250mg/5mlsyrupx60ml_tipturgh, paracetamol100mg/5mldropsx15ml_tipturgh, paracetamol1% w/v/100mlinfusion x100ml_tipturgh, paracetamol suppository170 mg1x5_tipturgh, paracetamol suppository80 mg1x5_tipturgh, pheniramine maleate22.75 mg/mlinjection1x2ml_tipturgh, pralidoxime chloride(2- pam)1g injection_tipturgh, premix insulin 30 is to 70 1x10ml40iu/mlinjection1x10ml_tipturgh, propofol1% oil suspension1% oil suspension1x10ml_tipturgh, rabies vaccine2.5iuinjection 1x0.mlwithdiluent1x1ml, rabies immunoglobin 1x2ml150iu/mlinjectionx2ml_tipturgh, ranitidine25mg/mlinjection 1x2ml, ringer lactateas per ip infusion 1x500ml_tipturgh, salbutamol nebuliser5mg/mlinhalation solution 1x15ml_tipturgh, sodium chloride (normal saline)0.9%w/v x500ml infusion 1x500ml_tipturgh, sodium chloride(normal saline)0.9%w/v x100mlinfusion 1x100ml_tipturgh, vecuronium4mginjection 1x2ml_tipturgh, vitamin k iv1mg/0.5mlinjection 1x1ml_tipturgh, zinc sulphate20mg(1x10x10)_tipturgh, zinc sulphate20mg/mlsyrup1x60ml_tipturgh, absorbent cotton wool1x500 gm_tipturgh, blood transfusion set 1x1_tipturgh, calamine lotion 100ml 1x100ml_tipturgh, endotracheal tubess with cuff (pvc)(sterile)_tipturgh, hbsag_tipturgh, infant feeding tubes6f _tipturgh, infant feeding tubes8f _tipturgh, plaster of paris bandage (isi/iso/ce)15cmx2.7mts _tipturgh, ryles tubess1

CTN :39786118

26 Mar, 2025 95.00 Lacs

Phalodi - Rajasthan

Tender For corrigendum : e tender for lab items - drabkin solution for hb estimation, tlc dilueting fluid, tlc pipette, dlc diluting fluid, dlc pipette, platelate count fluid, esr pipette disposable, anti a sera, anti b sera, anti d sera ( igg & igm), anti human globulin ( coombs reagent), normal saline, test tube glass 12 x75, test tube glass 12x100, droper plastic, slide pkt iso mark, cover slips 18x18, giemsa stain, leishman stain, paraffin oil, slide tray aluminum, distilled water, methanol, reticulocyte count fluid, methylene blue soln, brilliant cresyl blue soln, eosinophill count fluid, hemocytometer ( counting chamber ), bt ct capillary, filter paper, stop watch/timer, alcohol swabs, sickling test for sickle cell anemia, sickling rapid test for sickle cell anemia, nestroft test for screening of thalessemia, dcip for screening for hbe hemoglobinopathy, quantitative test g6pd deficiency, malaria rapid card test, pt reagent, sodium citrate tube for pt test, aptt reagent, calcium chloride soln, hcg ( pregnancy card), urine strips for ph,sg,tlc,glu,bil,uro,ketone,protein,nitrate, urine container plastic 30ml, test tube disposable plastic 12x100 ( 4 " ), urine strips for microalbumin, urine strips for acr, test kit for stool for ova and cyst, test kit for occult blood, semen diluting fluid, dengue rapid card test (igg,igm & ns1 ag combo), typhoid card test antibody, rpr /vdrl test for syphilis ( rapid card tests), rapid test card for the simultaneous detection of malara pv/pf antigen, s.thphi ( igm antibodies) and dengue ns1 antigen from a single card ( combo), hiv rapid card test with single step procedure ( serum and plasma), hbsag rapid card test 0.1 iu/ml senstivity, anti hcv rapid card test, rapid test card for the simultaneous detection of hiv 1& 2,hcv,hbsag ,syphilis from a single card ( combo), afb stain kit, widal test kit, blood sugar kit, gtt test kit, bilirubin total & direct kit, creatinine kit, urea test kit, uric acid test kit, sgpt test kit, sgot test kit, alkanine phosphate test kit, total protein test kit, albumin test kit, globulin test kit, total cholesterol test kit, triglycerides test kit, vldl direct test kit, hdl direct test kit, ggt test kit, amylase test kit, iron test kit, tibc test kit, hba1c test kit, s.calcium kit, s.magnesium test kit, acid phosphatest test kit, grams stain soln, thorat swap for diphitheria, visual inspection acetic acid, rk 39 for kala azar by rapid card test, smear for filaria, montex test 5tu, montex test 10tu, tuberculin syring for montex test, troponin i rapid card test, trop t rapid card test, ra quantitative test kit, crp quantitative test kit, aso quantitative test kit, blue tips, clot activator non vaccum tube double cap, edta nonvaccum tube double cap, jsb stain 1, jsb stain 2, keto stix, lugol iodine, methanol 5ltr, microscope bulb, printer paper roll 57mmx10mtr, printer paper roll 57mmx20mtr, sodium citrate soln, sodium hypochlorite soln, tissue paper roll, urine strips 04 parameter, yellow tips, electrolyte analyzer as per enclsoed technical specifications, 5 part hematology analyzer as per enclosed technical specifications, fully automated immunoassay analyzer ( clia) as per enclosed technical specifications, semi automated bioschemistry analyzer as per enclosed technical specifications

CTN :39807687

09 Apr, 2025 NA

Anantnag - Jammu And Kashmir

Tender For e.nit no 03 gmca of 2025 for reagents, drugs and medical consumables - tender for reagents, drugs and disposables., inj. cefuroxime 1.5 g, inj.clindamycin 600 mg, inj.succinylcholine 50mg/ml, inj.vasopressin, inj.physostigmine, inj.anti rabies serum, inj.anti rabies vaccine, inj. piperacillin tazobactum 2.25 gm, inj.isoprenaline 2mg/ml, inj. dextrose normal saline 500 ml, inj. normal saline 500 ml, inj.iron sucrose, inj. tetanus toxoid, inj. diltiazem 5mg, inj.streptokinase, inj.tenectapilase, inj. vitamin k, inj. infusion haemaccel 500 ml, inj. teicoplanin, inj. methyl prednisolone 125 mg, inj. methyl prednisolone 500 mg, inj.xylocard 2%, inj. digoxin, inj.heparin 25000iu, inj.insulin 30/70, inj. haemaccel (3.5% colloidal infusion solution ) 500 ml, inj. biphasic insulin 30/70 40iu, inj.dextrose 5%, inj.paracetamol infusion 100 ml, inj.teicoplanin, iv fluid set, dispo syringe 5ml, dispo syringe 3 ml, dispo syringe insulin 31 g, angiocath 24 g/18 g, urine collection bag adult, glucometer strips along with meter, absorbant cotton 500 gm, gauze cloth than, sodium hypochlorite 5% and 10 %, av tubing blood lines, av fistula needles 16/17 g, citrosterile disinfectant 5 ltr can, diasafe plus filter, haemobicarb part a+part b, introducer needles, disposable pressure transducer, transducer protector, hollow fiber dialyzer, femoral catheter 14cm*14cm, ecg paper 210mm 20 mtr (ecg 9108 z-fold paper), antisera d 10 ml, widal kit, crp omega kit, aso kit, distilled water can 5 ltr, erba diluent h560, erba lyse -i h560, erba lyse -ii h560, glutaraldehyde solution(cidex) 5ltr, hiv elisa, dispo shoe cover, dispo blanket cover, dispo gown, ahg gel cards -matrix, abo gel cards -matrix, lyss -matrix 250ml, ahg coombs sera 5 ml, antisera abd 10 ml (tulip), anti sera ab 10 ml, anti sera a1 5 ml, pipette multi channel 10-100 micro litre, pipette multi channel 100-1000 micro litre, formalin liquid 5 ltr, hydrophilic foldable lens a/s, hydrophobic foldable lens a/s, rigid lens a/s, iris claw lens a/s, glass slides 75*25 mm 1*50, inj.erythropoitin 10000iu pfs, inj carboprostate tromethamine 250 mcg, inj etomidate, inj glycine 3000ml, inj valthamate bromide, macintosh apparan, mersilk (1) 5062, dispo molin sheets, monocryl (3-0), nasal oxygen set paediatric/ neonate/ adult, sr. blood urea (tulip/ranbaxy/meril/span), antisera-d 10ml (tulip), sr. albumin (tulip/ranbaxy/meril/span), sr. alkaline phosphate (tulip/ranbaxy/meril/span), sr. calcium (tulip/ranbaxy/meril/span), sr. creatinine (tulip/ranbaxy/meril/span), sr. phosphorous (tulip/ranbaxy/meril/span), sr. sgot (tulip/ranbaxy/meril/span), sr. sgpt (tulip/ranbaxy/meril/span), sr. total protein (tulip/ranbaxy/meril/span), stromatolyzer 500ml reagent for sysmex machine, cell pack 20 liter reagent for sysmex machine, tablet misoprostol 200mg, umbilical card clamp, usg paper type-v (sony), dynoprostone gel, iv set/ drip set, cautery pencil, ctg paper 151mm*90mm*150 sheets (bristal indian), phenyl black 5liter, cell clean 5ml sysmex, cell cleaner erba 5ml, qc erba high/low/normal, qc sysmex high/low/normal

Medicines Scrap Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector