Latest menthol Tenders | Government menthol Tenders

Central Government/Public Sector

CTN :39838090

08 May, 2025 NA

Jabalpur - Madhya Pradesh

Tender For supply of bromhexine 2 mg + guaifenesin 50 mg + menthol 0.5 mg/5 ml 100 ml syrup firms offer:-coughmate br syp [quantity tolerance (+/-): 5 %age , item category : normal , total po value variation permitted: max 8 lacs ]

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39846599

16 Apr, 2025 NA

East Singhbhum - Jharkhand

Tender For supply of mg domperidone 30 mg. cap or tab. , pantaprazole 40 mg . tab. , rabiprazole 20 mg domperidone 30 mg. tab. , omeprazole 20 mg. cap , ondansetron 4 mg. tab. , calcium 500 mg. tab. , allopurinol 100 mg. tab. , febuxostat 40 mg. tab. , betahistine 8 mg. tab. , albendazole 400 mg. tab , i. v. sodium chloride 0.9 percent 500 ml , i.v. mannitol 20 percent 100ml , levolin respules 0.31 mg , budecort respules 0.5 mg , olmesartan 40mg. tablet , teneligliptin 20mg. tablet , ors 21.8gms. , i.v sodium chloride 0.9 percent 100ml. , diclofenac 50mg tablet , paracetamol 650mg tablet , dexamethasone sodium phosphate 4mg. injection 2ml. , promethazine hydrochloride 25mg injection 2ml. , lignocaine hydrochloride 2 percent injection 30ml. , lignocaine hydrochloride and adrenaline bitartrate injection 30ml. , metoclopramide hydrochloride 5mg. injection 2ml. , phenytoin sodium 50mg. injection 2ml. , dopamin hydrochloride 40mg injection 5ml. , etofylline and theophylline injection 2ml. , frusemide 10mg injection 4ml. , diphenhydramine hcl ammonium chloride sodium citrate and menthol syrup 100 ml cough syrup , paracetamol 125 mg tab , i.v dextrose 25 percent 100 ml , drotaverine hychloride 40 mg injection , ondansetron 2 mg injection , hyoscine butylbromide 20 mg injection , pantoprazole 40 mg injection , cefuroxime 500 mg tab , paracetamol injection , diazepam injection , pentazocine injection , etophylline and theophylline 150mg tablet , etophylline and theophylline 300mg tablet , hydrocortisone sodium 100 mg injection , adrenaline bitartrate injection , atropine sulphate injection , dapagliflozin 10mg , tetanus toxide 0.5 ml injection , lignocaine 2 percent jelly 30 gms , i.v electrolyte p 500 ml

State Government

CTN :39427390

07 Apr, 2025 NA

Multi City - Multi State

Tender For corrigendum : e-tender enquiry for supply of lab chemicals/reagents/kits item

Co-operative

CTN :39810550

01 Apr, 2025 90.00 Lacs

Jaipur - Rajasthan

Tender For e-tender document for supply of lab chemicals and glass ware / potassium permaganate/surgical gloves / iso amyl alcohal - potassium permagnate crystal (commercial grade), tsp (tri sodium phosphate) commercial grade, salt a (per 500 ml pack), absolute ethanol (per 500 ml pack), sulphuric acid lab grade ( 5 lit. plastic jar pack), iso amyl alcohol lab grade (500ml pack) (melting point:- 117.2 degree c) (boiling point:- 131 degree c ) density:- 0.810 kg/1,) (solubility:- water 25 g/1 at 20 degree c) refractive index:- 20/d 1.4053 physical description :- liquid, qualigens, e-merck, cdh, qualikems, rankem, lab chemicals & glassware, ranbaxy, sd fine, glaxo / qualigens universal, e-merck, loba, himedia, borosil, duran (germany) / ravira, qualikems, supertek, satol, polylab, religlass, cdh, whatman, diversey, dorson, moxcare, abdos, butyrometer ( benny make), for cream, for butter, for milk, for cheese, surgical gloves sterlized size 7.5" & 8", surgical gloves non-sterlized size 7.5" & 8", nitrile gloves(food grade), halyard, moxcare, labserv, kimberly-clark, cotton absorbent 500 gm / 400 gm pack, cotton non-absorbent 500 gm / 400 gm pack, disposable cap, disposable face mask, thermometer 0-110 deg.c (dimple make), type:alcohol, type:mercury, lactometer-(20 to 40 range) 15.5 c, jupitor, benny, jk, lactometer supreme quality dual tested range:0-40@84 deg f,accuracy: 0.0002, division:0.001 (jk make), lock stopper (make benny), rubber cork no.1 for test tube, edta commercial grade, pipette 10.75 ml super delux benny make, water bath- ordinary, water bath- serological, water bath- with thermostatically, hot air oven (s.s.), hot plates round, 8 inch, 12 inch, b.h.a. food grade, digital thermometer- 10 deg.c to 250 deg.c, b.r. meter, distilled water, filter paper grade 4, size:125 mm, dorson, whatman, filter paper grade 41, size:125 mm, dorson, whatman

CTN :39832873

09 Apr, 2025 NA

Bhadradri Kothagudem - Telangana

Tender For suppy of r.o, boiler and lab chemicals, equipments for oil palm processing units at ashwaraopet and apparaopet, bhadradri kothagudem dist., telangana state

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri

CTN :39812948

01 Apr, 2025 90.00 Lacs

Jaipur - Rajasthan

Tender For e-tender document for supply of lab chemicals and glass ware / potassium permaganate/surgical gloves / iso amyl alcohal at jaipur dairy

corporations/Associations/Others

CTN :39824667

31 Mar, 2025 NA

Tuticorin - Tamil Nadu

Tender For ttps operation circle chemical division plant operation works of dm plant-i ii, collection of swas samples, dosing of chemicals, collection of stator water and hydrogen gas samples at express lab-i ii on round the clock basis for 6 months

CTN :39562316

28 Mar, 2025 NA

Patiala - Punjab

Tender For bid to ras supply of 500mg tab , mebeverine 135 mg tab mebaspa , metoprolol xl 12.5 mg tab , mirabegron 25mg tab cap , mirabegron 50 mg tab , multivitamin syp , nasal spray calcitonin 200iu , nebivolol 5 mg tab , nintedanib 150 mg cap , pancreatin 10000 iu tab , paroxetine 12.5mg tab , prasugrel 10 mg tab , pregablin 75 mg , prucalopride 2 mg tab , rabeprazole 20mg plus itopride 150mg tab , ranolazine 500 mg tab , rifaximine 400mg tab , sacubitril 97mg plus valsartan 103mg tab , salbutamol 200 mdi each metered dose supplies 100mcg of salbutamol mdi , salmeterol 50mcg plus fluticasone propionate 250mcg seretide accuhaler 50 250 , serratiopeptidase 10 mg tab , sertraline 50 mg tab , sevelamer foseal 800 mg tab , silodosin 4 mg tab , sodium valproate 500 mg tab , sofosbuvir 400mg plus velpatasvir 100mg cap , solifenacin 10 mg tab , spironolactone 50 mg aldectone , syp cough expectorant 100 ml , syp lactulose 200 ml , syp peractin cyproheptadine , tadalafil 5 mg , telmisartan 40 mgplusamlodipine 10 mg tab , tenofovir alafenamide 25 mg tab , tetrabenzeme 25mg tab , torsemide 40 mg tab , trimetazidine 20 mg tab , trimetazidine 60 sr tab , trypsin chymotrypsin diclofenac chymoral forte d tab , ursodeoxycholic acid 450 mg tab , ursodeoxycholic acid 600mg tab , ursodexycholic acid 300mg tab udiliv , vildagliptin 50mg tab , vit a d e c b1 b12 folic acid biotin menopace , volini gel tube of 50 gm linseed oil plus diclofenac plusmethyl salicylate plus menthol gel , zolpidem 10 mg tab , calcium carbonate plus calcitirol plus methulcobalamin plus vitamin k2 and zinc tab , chlordiazepoxide 5 mg plus clidinium bromide 2.5 mg librax 5 plus 2.5 , glimepiride 2mg plus metformin 500mg tab , glucosamine 500 mg pluschondriotin 400 mg tab , glucosamine 750 mg plus diacerine 50 mg tab , methylcobalamin 1500mcg plus alpha lipoic acid 100mg plus myo-inositol 100mg plus folic acid 1.5mg plus chromium picolinate 200mcg plus selenium 55mcg plus benfotiamine 150mg nuhenz cap , omega 3 fatty acid cap , polyethylene glycol purgative powder ip 118gm. sod chloride 2.93 gm pot chloride 1.484 gm sod bicarb 3.37 gm sod sulphate 11.35gm bid details/ 2 / 63

Menthol Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

State Government

Co-operative

corporations/Associations/Others