Latest mill sanitation Tenders | Government mill sanitation Tenders

CTN :39844118

10 Apr, 2025 1.24 Lacs

Haveri - Karnataka

Tender For supply of lab consumables and chemicals and various items to hims haveri - novachrom cold. afb .staining kit., gram.s stain. kit.1 kt, glass vails with rubber cap 30 ml., blotting .paper., escherichia coli atcc 25922., staphylococcus aureus .atcc 25923., tissue. roll., tripple layer. mask., hand gloves.., absorbant cotton .., sodium. hypochlorite., spirit.., urine collection containers., sterile swab sticks with stick., tube cleaning brush., lab clean., phenol.., micro. slides., concave slides., inoculation loop .4mm with handle., inoculation loop .2mm with handle., urea agar .base., triple sugar .iron agar., mannitol motility. test medium., peptone water., mac.conkeys agar. , culture plates .disposable., ziehl.nielsen stain., xylene., test tubes .18x150mm., test tube. holders., sulphur .500g., sulphosalycilic .acid. , spirit surgical 4.5l., sodium nitroprusside .100g., sodium .hypo .chloride ., sodium hydroxide .500g., sodium chloride .500gm., plastic tray .small., plastic tray big., paraffin wax 1kg., normal saline 500ml., nitric acid 2.5l., methanol acetone. free .2.5l, litmus paper red packet., leishman.s stain. with buffer. 500ml, hydrogen peroxide .500ml., hydrochloric .acid 2.5l., hematoxylin and .eosin., glass slides .pack of 50., funnels .plastic., fouchet.s reagent. 125ml, formalin 37 to 41., filter .paper., ferric .chloride .500g., ethanol 500ml., esbach.s reagent. (500ml)., dropper .3ml., dropper .1ml., dpx .500ml., distilled .water 5l., dextrose .500g., cover slips 22x50mm .10gm., cover slips 22x22mm 10gm., cotton rolls .500g., cedar wood oil .used on glass slides 25ml., benedicts .reagent. 5l., basin. steel., barium chloride .500g., antiserum.blood grouping 10ml., ammonium. oxalate .500gm, ammonia .500ml., acetone. 500ml., box canting 25 pieces., one box .100 pieces., pantoprazole .domperidone .strip of 10., ibuprofen paracetamol strip of 10, ciprofloxacin .tinidazole .strip of 10., antacid .gel . mg ., cotrimoxazole .strip of 10. , carbidopa levodopa tablets .strip of 15. , povidone iodine .solution .100ml bottle , calamine lotion 177 ml .bottle., neomycin sulphate, polymyxin b, bacitracin zinc ointment .10 g tube, oral rehydration salts powder 21.8 g sachet, dextran 40 .500 ml., ringer lactate .500 ml., dextrose 500 nil., iv fluids normal saline 500 nil., liquid .paraffin emulsion 100 ml bottle., cefixirne dry syrup reconstituted suspension .30 ml bottle., saline nasal drops solution 10 ml bottle, adrenaline tartrate injection 1 ml ampoules, neomycin sulphate polymyxin b bacitracin zinc powder 10 g bottle, amoxicillin .capsules strip of 15., isosorbide dinitrate sublingual tablets .strip of 10., clotrimazote vaginal pessaries mucoadhesive .extended nrelease tablets packet of 6., nicotine or glyceryl trinitrate transderrnal .patches. , oxymetazoline. hydrochlorid nasal spray 10 ml bottle, aspirin . dispersible .tablets strip of 10, insulin pens box of 1., rotahaler device packet .of 1, spacer device box of 1., metered dose inhalers .salbutamol , tissue .roll., plain slides each .box containing 100 slides., slide cover slips each. box containing 100 pieces., disposable mask each .box containing 50 pieces., m size hand gloves. each box containing .100 pieces., spirit. liters 5 l., cotton big roll, thin rubber. sheet in mtrs 2mm., reusable. plastic aprons. , formalin 20 ltrs can , ziehl. nielsen .stain., spirit .surgical. , sodium .nitroprusside. , sodium .hypo chloride. , sodium .hydroxide. , sodium .chloride. , plastic tray. small., plastic .tray .big., paraffin .wax. , normal .saline., glass .slides. , distilled .water., dextrose.., cover. slips 22x50mm. , cover slips 22x22mm. , cotton. rolls, capillary tubes for clotting time estimation., dropper 3ml., glass slides 75mm x 25mm,thickness1.1mm., disposable mouth piece for. spirometry., ecg.. gel., ecg thermal paper roll 80mmx20mtr., antisera for blood grouping.., ethanol 500ml., cedar wood oil 25ml., surgical blade no. 15. , slide .staining rack with bunsen burne

CTN :39832873

09 Apr, 2025 NA

Bhadradri Kothagudem - Telangana

Tender For suppy of r.o, boiler and lab chemicals, equipments for oil palm processing units at ashwaraopet and apparaopet, bhadradri kothagudem dist., telangana state

Co-operative

CTN :39810550

01 Apr, 2025 90.00 Lacs

Jaipur - Rajasthan

Tender For e-tender document for supply of lab chemicals and glass ware / potassium permaganate/surgical gloves / iso amyl alcohal - potassium permagnate crystal (commercial grade), tsp (tri sodium phosphate) commercial grade, salt a (per 500 ml pack), absolute ethanol (per 500 ml pack), sulphuric acid lab grade ( 5 lit. plastic jar pack), iso amyl alcohol lab grade (500ml pack) (melting point:- 117.2 degree c) (boiling point:- 131 degree c ) density:- 0.810 kg/1,) (solubility:- water 25 g/1 at 20 degree c) refractive index:- 20/d 1.4053 physical description :- liquid, qualigens, e-merck, cdh, qualikems, rankem, lab chemicals & glassware, ranbaxy, sd fine, glaxo / qualigens universal, e-merck, loba, himedia, borosil, duran (germany) / ravira, qualikems, supertek, satol, polylab, religlass, cdh, whatman, diversey, dorson, moxcare, abdos, butyrometer ( benny make), for cream, for butter, for milk, for cheese, surgical gloves sterlized size 7.5" & 8", surgical gloves non-sterlized size 7.5" & 8", nitrile gloves(food grade), halyard, moxcare, labserv, kimberly-clark, cotton absorbent 500 gm / 400 gm pack, cotton non-absorbent 500 gm / 400 gm pack, disposable cap, disposable face mask, thermometer 0-110 deg.c (dimple make), type:alcohol, type:mercury, lactometer-(20 to 40 range) 15.5 c, jupitor, benny, jk, lactometer supreme quality dual tested range:0-40@84 deg f,accuracy: 0.0002, division:0.001 (jk make), lock stopper (make benny), rubber cork no.1 for test tube, edta commercial grade, pipette 10.75 ml super delux benny make, water bath- ordinary, water bath- serological, water bath- with thermostatically, hot air oven (s.s.), hot plates round, 8 inch, 12 inch, b.h.a. food grade, digital thermometer- 10 deg.c to 250 deg.c, b.r. meter, distilled water, filter paper grade 4, size:125 mm, dorson, whatman, filter paper grade 41, size:125 mm, dorson, whatman

State Government

CTN :39427390

07 Apr, 2025 NA

Multi City - Multi State

Tender For corrigendum : e-tender enquiry for supply of lab chemicals/reagents/kits item

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39824667

31 Mar, 2025 NA

Tuticorin - Tamil Nadu

Tender For ttps operation circle chemical division plant operation works of dm plant-i ii, collection of swas samples, dosing of chemicals, collection of stator water and hydrogen gas samples at express lab-i ii on round the clock basis for 6 months

CTN :39604807

29 Mar, 2025 NA

Junagadh - Gujarat

Tender For corrigendum : e-tender notice for annual rate contract (arc) chemicals / reagents / glassware & plastic ware / lab ware / specimens / miscellaneous items / gases /[minor laboratory equipment / instruments (costing not more than rs. 1.0 lakh)]

CTN :39697183

29 Mar, 2025 NA

Multi City - Telangana

Tender For corrigendum : supply of lab chemicals-, supply of iso -prophyl alcohol on contract basis., supply of hydrochloric acid (lr grade) on contract basis., supply of ammonium sulphate on contract basis., supply of potassium permanganate on contract basis., supply of formaldehyde on contract basis., supply of iso amyl alcohol on contract basis., supply of absorbent cotton on contract basis., supply of non-absorbent cotton on contract basis, supply of phmeter on contract basis., supply of tds conductivity meter on contract basis., supply of weighing balance 5kg on contract basis., supply of cast iron weight 20 kg on contract basis, supply of gsm cutter with weighing balance on contract basis, supply of digital thickness gauge micro meter on contract basis, supply of digital vernier caliper on contract basis, supply of digital micro meter screw gauge micro meter on contract basis

CTN :39812948

01 Apr, 2025 90.00 Lacs

Jaipur - Rajasthan

Tender For e-tender document for supply of lab chemicals and glass ware / potassium permaganate/surgical gloves / iso amyl alcohal at jaipur dairy

CTN :39776930

29 Mar, 2025 962

Mysore - Karnataka

Tender For supply lab euipments for adarsha pu colleges mysuru district - ddpumys plane mirrors, ddpumys object stand, ddpumys image screen, ddpumys lens stand metal, ddpumys slotted weights with hanger (each 0.5kg), ddpumys pointer galvanometer, ddpumys physical balance, ddpumys steel balls of different radis, ddpumys thermometers, ddpumys surface tension apparatus with full set, ddpumys spirit level, ddpumys inclined plane with protractor and pulley,roller,weight box,spring balance,, ddpumys rheostat, ddpumys connecting wires, ddpumys wire cutter, ddpumys sonometer with wire,electromagnet, slotted weights with hanger(frequency of ac appts), ddpumys copper calorimeter with lid,with full set, ddpumys beam balance weight box with a set of milligram masses, ddpumys newtons law of cooling appts, ddpumys coefficient of friction full set, ddpumys viscosity appts stokes method (with glass tube), ddpumys parallelogram of force apparatus(wooden stand type), ddpumys inclined plane full set apparatus, ddpumys conversion of galvanometer into ammeter, ddpumys conversion of galvanometer into voltmeter, ddpumys semiconductor diode full set inbuilt apparatus (with two digital meters)both forward and reverse bias, ddpumys battery eliminator a.c/d.c(3amp), ddpumys glass prism, ddpumys glass slab, ddpumys concave mirror (15cm,20cm), ddpumys double convex lens (10cm,15cm,20cm), ddpumys double concave lens(10cm,15cm,20cm), ddpumys optical bench double rod (1m)(ss rod) set, ddpumys intermediated travelling microscope, ddpumys tuning fork full set(medium quality), ddpumys rubber hammer, ddpumys wooden hammer, ddpumys rubber pad, ddpumys resonance apparatus(stainless steel), ddpumys stabilized variable power supply 0-5v,1amp, ddpumys standard resistance box 1 ohm-100 ohm, ddpumys standard resistance box 1 ohm-10000 ohm, ddpumys leclanche cell, ddpumys daniel cell, ddpumys plug key 1way,2way, ddpumys d.c. volymeter 0-5v, ddpumys d.c. ammeter 0-5a, ddpumys d.c galvanometer, ddpumys d,c millivoltmeter 0.25-750mv, ddpumys d.c milliammeter 500ma, ddpumys boyles law apparatus, ddpumys spring balance full set apparatus, ddpumys simple pendulum complete set apparatus, ddpumys stop clock-2, ddpumys spherometer 1/100, ddpumys micrometer screw gauge 25x1mm, ddpumys vernier calliperse, ddpumys one meter long rule scale, ddpumys two way gas tap, ddpumys stop clock, ddpumys winchestor bottle-10lt,5lt,2lt,3lt, ddpumys watch glass 3 inch, ddpumys wire guaze, ddpumys wash bolle(polythene)-500ml, ddpumys volumetric flask-250ml,100ml, ddpumys thermometer -1ooc,360c, ddpumys tripod stand, ddpumys test tube brush, ddpumys test tube holder, ddpumys test tube stand, ddpumys test tubes-15ml, ddpumys sample bottles-50ml(plastic), ddpumys spatula, ddpumys rubber corks-different sizes, ddpumys reagent bottle (amber)-250ml, ddpumys reagent bottle -250ml,125ml, ddpumys platinium wire(loop), ddpumys measuring cylinder(plasric)-1000ml,500ml, ddpumys porcelein tiles, ddpumys pile (for cutting), ddpumys porcelain dish, ddpumys pipette stand, ddpumys pipette-10ml, ddpumys mortor and pestle, ddpumys capillary tubes, ddpumys melting point.p apparatus(thick tube), ddpumys measuring cylinder(borosil)-250ml,100ml,50ml,10ml, ddpumys glass trough, ddpumys gas cylinder with regulator, ddpumys glass tube, ddpumys glass rod, ddpumys funnel glass plastic, ddpumys digital balance, ddpumys conical flask(borosil)-250ml,100ml, ddpumys boiling point set, ddpumys burette stand, ddpumys burette 50ml plastic, ddpumys beaker plastic- 2 lt,1lt, ddpumys beakers (borosil),500ml,250ml,100ml, ddpumys bunsen burner, ddpumys analytical weight box plus fractionalweight box, ddpumys analytical balance(chemicals), ddpumys precaution chart, ddpumys periodic table-big, ddpumys p h paper, ddpumys fehlings solution, ddpumys benedicts solution, ddpumys sciffs reagent, ddpumys manganous sulphate, ddpumys zinc carbonate, ddpumys zinc sulphate, ddpumys universal indicator, ddpumys starch, ddpumys sulphuric acid, ddpumys sodium hyd

Mill Sanitation Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Co-operative

State Government

Central Government/Public Sector

corporations/Associations/Others