Latest monteleukast tab Tenders | Government monteleukast tab Tenders

Central Government/Public Sector

CTN :39848740

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.24) iv solution ringer lactate containing sodium hydroxide 0.32gm, sodium chloride 0.50gm, potassium chloride 40mg, calcium chloride mg, 500ml bottle

Central Government/Public Sector

CTN :39848743

30 Apr, 2025 NA

Delhi - Delhi

Tender For supply of 2025-26 (ami no. 30.04) infusion dextrose 5% w/v with 0.9% w/v sodium chloride solution iv 500ml bottle

CTN :39835124

16 Apr, 2025 NA

Imphal - Manipur

Tender For supply of drugs and medicine - hydroxyethyl starch , adenosine , adrenaline , amikacin 250 mg , amikacin 375 mg , amikacin 500 mg , amikacin100 mg , amiodarone , amoxicillin , amoxicillin 250 mg and clavulanic acid 50 mg inj , amoxicillin 500 mg and clavulanic acid 125 mg tab , antacid gel , atracurium besylate , atropine , azithromycin 500 mg tab , betadine mouth gargle , bicarbonate solutions , botropase , bupivacaine , butorphenol , calcium gluconate , cefoperazone sulbactam , cefotaxime 125 mg , cefotaxime 250 mg , ceftriaxone 1 gm , ceftriaxone 125 mg , ceftriaxone 250 mg , ceftriaxone 500 mg , ceftriaxone with sulbactum 1.5 gm , ceftriaxone with sulbactum 375 mg , ceftriaxone with sulbactum 750 mg , chlorhexedine gluconate soln , cis-atracurium , desflurane , dexamethasone , dexmedetomidine , dextrose 10 percent 500 ml iv inj , dextrose 25 percent 100 ml iv inj , dextrose 5 percent 500 ml iv inj , dextrose 5 percent and sodium chloride 0.9 percent 500 ml iv inj , diclofenac aq , dobutamine , dopamine , doxophylline , eldex p , enoxaparin 40mg , enoxaparin 60mg , esmolol , etophylline and theophylline , fentanyl citrate , frusemide , glutaraldehyde neutralyser , glutaraldehyde solution , glycopyrrolate neostigmine methylsulphate , glycopyrrolate , hand sanitizer , heloperidol , heparin , human normal albumin , hydrocortisone , hydrogen peroxide 30 percent , hydrogen peroxide 6 percent , sugammadex , isoprenaline , ketamine , labetalol , levofloxacin , lignocaine 2 percent 30 ml , lignocaine 2 percent jelly , lignocaine 2 percent with adrenaline , lignocaine 4 percent 30 ml , lignocaine hydrochloride 2 percent , lorazepam 2 ml inj , mvi inj , magnesium sulphate , mannitol 20 percent 100 ml , mephentermine , meropenem 1 gm , meropenem 250 mg , meropenem 500 mg , methylprednisolone acetate , metoclopramide , metronidazole , midazolam , morphine tab , morphine inj , mupirocine ointment , naloxone , neostigmine , neutral detergent , nitroglycerin , nor adrenaline , ofloxacin and ornidazole , octreotide , ondansetron , oral rehydration salt , oxytocine , pantoprazole tab , pantoprazole inj , paracetamol inj , paracetamol 500 , paracetamol 650 , paracetamol iv inj , pentazocine , pethidine , pheniramine maleate , phenobarbidone , phenytoin sodium , piperacillin and tazobactum 1.125 gm inj , piperacillin and tazobactum 2.250 gm inj , piperacillin and tazobactum 4.5 gm inj , potassium chloride , povidone iodine 10 percent solution 500 ml , povidone iodine 5 percent solution 500 ml , povidone iodine ointment , prilox cream , promethazine 2 ml , propofol 1 percent 20 ml inj , rl iv inj , rabies vaccine human , ranitidine , rectified spirit , rocuronium bromide , ropivacaine , sevoflurane , snake venom antiserum , sodium bicarbonate , sodium chloride 100 ml iv inj , sodium chloride 1000 ml iv inj , sodium chloride 500 ml iv inj , sodium chloride 3 percent 100 ml iv inj , sodium hypochlorite , succinylcholine chloride , teicoplanin , tetanus toxoid , tinidazole , tpn solution , tramadol , tranexa inj , tranexamic acid tab , tuberculin purified protein derivative , vancomycin , vecuronium bromide , vitamin k , water for injection

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government / Public Sector

CTN :39835249

16 Apr, 2025 25.73 Lacs

North 24 Paragana - West Bengal

Tender For procurement of generic medicines - cream.permathrin 5 percent 30gm , drop.ciprofloxacin 0.3 percent eye 5ml , drop.xylometazoline 0.1 percent nasal decongestant adult 10ml , inj.dexamethasone 4mg per ml 2ml , inj.diazepam 10mg per 2ml , inj.dicyclomine 10mg per ml 2ml , inj.metoclopramide 5mg per ml 2ml , inj.ondansetron 2mg per ml 2ml , inj.pantoprazole 40mg , inj.pheniramine maleate 22.75mg , lignocaine hcl gelly 2 percent 30gm , lotion.povidone iodine 10 percent 500ml , mdi levosalbutamol 50mcg per dose , sterile water for injection 10ml , syr.albendazole 10ml , amoxycillin 200mg clavulanic acid 28.5mg and lactic acid bacillus 60 million spore dry syrup , syr.cefixime 50mg per 5ml bott of 30ml , tab.clobazam 5mg , tab.clopidogrel75mg , tab.enalapril 5mg , tab.escitalopram 10mg , tab.folic acid 5mg , tab.isosorbide 5 mononitrate 20mg , tab.levothyroxin 25mcg , tab.levothyroxine 100mcg , tab.levothyroxine 50mcg , tab.metformine 500mg sr , tab.metformin sr 1gm , tab.metoprolol 50 mg xl , tab.ondansetron 8mg , tab.prednisolone 5mg , tab.ramipril 5mg , tab.telmisartan 40mg , tab.telmisartan40 plus hydrochlorthz 12.5 mg , cap.tamsulosin 0.4mg , cap.vitamin e 400mg , ferrous ascorbate 100mg and folic acid 1.5mg tablets , clotrimazole1 percent powder 100gm , cream.silver sulphadiazine1 percent weight per weight 20gm , drop.ciprofloxacine plus dexamethasone 10 ml , drop.multivitamin bottle of 15ml , drop.sodium chloride nasal , inj.amikacin 250mg , inj.etophyllin 84.7mg plus theophylline 25.3mg per ml , inj.hydrocortisone sodium succ.100mg , inj.lignacaine 2 percent , inj.lignacaine 2 percent plus adrenalline , inj.tranexamic acid 500mg per 5ml , mdi ipratropium bromide plus levosalbutamol , oint.betamethasone 0.05 percent plus salicilic acid 3 percent 25gm , oint.mometasone 0.1 percent 10gm , oint.mupirocin 2 percent 5gm tube , heparin sodium 50iu and benzyl nicotinate 2mg ointment 20gm , levo-salbutamol 1.25mcg plus ipratropium 500mcg respules 2.5 ml , ambroxol hydrochloride 15 mg guaifenesin 50 mg and levosalbutamol sulphate 1 mg syrup , phenylephrine 5 mg chlorpheniramine 2 mg and dextromethorphan 10 mg syp , tab.aciclovir 800mg , tab.alprazolam 0.25mg , tab.aspirin enteric coated 150mg , tab.aspirin enteric coated 75mg , tab.betahistine hcl16mg , tab.cinnarizine 25mg , tab.etophylline-115 plus theophylline-35mg in slow release , tab.febuxostate 40mg , tab.fenofibrate 200mg , tab.finasteride 5mg , tab.glucosamin 500mg , tab.nor-ethisteron 5mg , tab.torsemide 10g , tab.voglibose 0.2mg , tab.voglibose 0.3mg , tab per cap.pregabolin 75mg , tab per cap.vitamin b complex b1 b6 b12 , antiseptic mouth wash chlorhexidineip 0.2 percent weight per volume 100ml , vit. d3 sachet cholecalciferol 60k , tab.teneligliptin 20mg , clotrimazole mouth paint 1 percent weight per volume 25ml , syp.ondansetron 2mg per 5ml 30ml , tab.montelukast10 plus levocetrizine , glyceryl trinitrate cr 2.6mg , mouth ulcer gel choline salicylate sodium 9 percent weight per volume benzalkonium chloride 0.01 percent weight per weight 10gm , drotaverine hcl tablets 40mg , atropine sulphate injection ip 0.6mg per ml 1ml , gabapentin capsules ip 300mg , carvedilol tablets ip 3.125 mg , tabsosorbide dinitrate ip 10mg , dopamine hydrochloride injection ip 200 mg per 5ml , streptokinase inj. ip 15 00 000 iu 10ml , carboxymethlycellulose eye drop 1 percent weight per volume 10ml , tranexamic acid tablets ip 500 mg , propranolol tablets ip 40 mg , lactulose solution 10g per 15ml 100ml , tab pregabalin sr75mg plus methylcobalamin 750mcg , sitagliptin phosphate tab. ip 100mg , dapagliflozin tablets 10 mg , inj.enoxaparin ip 40 mg per 0.4 ml , inj. enoxaparinip 60 mg per 0.6 ml , adenosine injection 3mg per ml 2 ml , phenytoin tablets ip 100 mg , metoprolol succinate pr 25mg tablets ip 25mg , rabeprazole gastro resistant tablets ip 20 mg , esomeprazole tablets ip 40mg , miconazole nitrate cream ip 2 percent , luliconazole cream ip 1 percent weight per weight 10gm , inj.tramadol

CTN :39846918

17 Apr, 2025 14.57 Lacs

Belgaum - Karnataka

Tender For supply of frusemide 40 mg amiloride hydrochloride 5 mg tab , pancreatic enzyme supplement lipase content of 25000 units cap , antispasmodic containing mefenamic acid 250 mg dicyclomine hcl 10 mg , tab levosulpiride 25 mg , tab entacavir 0 point 5 mg , antacid chewable aioh 3 300mg mg silicate 25 mg simethicone 25 mg , trypsin and chymotrypsin 6 ratio 1 100000 au enteric coated tab , ranitidine hcl 50 mg 2 ml inj , metoclopramide 10 mg tab , metoclopramide hcl 5mg ml 2ml inj , dicyclomine 20 mg paracetamol 500 mg tab , dicyclomine hcl 20mg inj , drotaverine hcl 20 mg per ml inj , hyoscine bromide inj 20 mg per ml 1ml inj , mebeverine hcl 135mg tab , isapgol ispaghula husk 3 point 5 gm , bisacodyl 5 mg tab , parraffin liq in bottle of 100 ml , pancreatic enzyme cap lipase content of 10000 to 20000 units , loperamide 2mg tab , pantoprazole 40 mg domperidone sr 30 mg cap , pantoprazole 40 mg levosulpride 75 mg cap , rifaximine 400 mg tab , ethinyl estradiol 0 point 035mg cyproterone acetate 2mg pack of 21 tablets , oestrogen cream concentration 0 point 06 percent to 0 point 1 percent tube of 15 to 50 gms , clotrimazole vaginal pessary 100mg , levonorgestrel 0 point 25 mg ethinylestradiol 0 point 03mg pack of 21 tab , nor ethisterone 5mg tab , gliclazide mr 30 mg tab , glipizide 5mg tab , glibenclamide 5mg tab , sitagliptin 50 mg metformin 1000mg tab , linagliptin 2 point 5 mg metformin 500 mg , pioglitazone hydrochloride 15 mg tab , carbimazole 5 mg tab , alendronate sodium 70mg tab , pyridostigmine 60 mg tab , calcium acetate 500 mg tab , protein supplement for predialysis renal failure , sevelamer 400 mg tab , betaxolol eye drops 0 point 25 percent 0 point 5 percent bott of 5 ml , chloramphenicol 0 point 5 percent dexamethasone sodium 0 point 1 percent bott of 5 ml , ciprofloxacin hcl 0 point 3 percent dexamethasone 0 point 1 percent bott of 5ml , gatifloxacin 0 point 3 percent eye drop bott of 5 ml , gentamicin sulphate 0 point 3 percent gentamicin base with hydrocortisone acetate ip 1 percent eye ear drops bott of 5 ml , ketorolac tromethamine 0 point 4 percent eye drops , brimonidine tartrate 0 point 2 percent eye drops , methyl cellullose 2 percent solution bottle of 5 ml , ofloxacin 0 point 3 percent bott of 5 ml , luliconazole cream , timolol maleate eye drop 0 point 5 percent bott of 5 ml , tobramycin 0 point 3 percent bott of 5 ml , e d moxifloxacin dexamethasone , brimonidine 0 point 2 percent timolol 0 point 5 percent eye drops , latanoprost 0 point 005 percent w per v eye drops , beclomethasone dipropionate nasal spray 50 mcg per dose metered dose 150 units , mometasone nasal spray , fluticasone furoate 27 point 5 mcg nasal spray , betahistine dihydro chloride 8mg tab , cinnarzine 25 mg tab , clotrimazole 1 percent w per v ip lignocaine 2 percent w per v ip ear drop bott of 10ml , chloramphenicol 5 percent clotrimazole 1 percent betamethasone 0 point 25 percent lignocaine hcl 2 percent in bott of 5 ml , nasal decongestant adult drops xylometazoline hcl 0 per 1 percent nasal drop bottle of 10 ml , xylometazoline hcl 0 point 05 percent nasal solution for paed use bott of 10ml , cyproheptadine hcl 2 mg per 5ml bott of 100 ml , domperidone syp 1 mg per ml bott of 30 ml , norfloxacin syp 100mg per 5ml bott of 30 ml , ondansetron syp 2 mg per 5ml in bott of 30 ml , levo salbutamol syrup 1 mg per 5ml bottle of 100 ml , alprazolam 0 point 25 mg tab adapalene 0 point 1 percent tube of 15 gm, tacrolimus oint , benzoyl peroxide , calamine lotion 50 ml tube, bid details/ 2 / 83

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

CTN :39482582

08 Apr, 2025 NA

Srinagar - Jammu And Kashmir

Tender For corrigendum : supply of various reagents, at skims, soura, srinagar on one year rate contract basis. - media, agarose (low eeo), dna ladder (100 bp), dna ladder (50 bp), dna zap, rnase zap, dntps, gel loading buffer dye, glycerol (mol. biology), isoamyl alcohol (mol. biology), isopropanol (mol. biology), lysozyme (powdered), magnesium chloride (25mm), potassium acetate 3m (ph 5.2), primers, proteinase k, sodium acetate 3m (ph 5.2), sodium hydroxide (mol. biology), tae buffer (50x), te buffer, tris borate edta buffer (50x), anti a, anti b, anti ab, anti d (monoclonal), anti d (polyclonal), anti a1 (lectium), ahg coombs, anti h, bovines albumin, papain, anti c, anti c, anti e, anti e, hb prostrip, taq dna polymerase, hla positive control, hla negative control, rabbit complement lyophilized, heparin salt, density gradient sol. 10.77g/dl, dnase, mgcl2 solution (25mm), diluent, lyse, probe cleanser, glucose reagent (god pod), uristix 2 parameter, uristix 10 parameter, fetal bovine serum (fbs), pha m, trypsin (lyophilized), 25 bp ladder, sybr green, dmem media, eco 321, hinfi, mbo i, ddeli, ecor v, di-george probe (22q del), wolf-hirschhorn region probe, williams region probe, ip deletion probe, angelmann, praderwilli probe, kallman region probe, cri-du-chat region probe, snrpn region probe, fish implementation kits, probe for her 2, probe for alk, aneuploidy probes (trisomy 13), aneuploidy probes (trisomy 18), aneuploidy probes (trisomy 21), rpmi 1640 lyophilised with l-glutamine & phenol red indicator., heparin, oct (optimal cutting temperature embedding medium), oil red o , orange g (powder), microscopic immersion oil (cedar wood oil), mineral oil, pylocarpin, safranin, sodium hydroxide pellets mw 40, temed, triton x 100, trizol, trypsin 2.5% (tissue culture grade), turks fluid, tween 20, tween 80, wax (congealing point 600c), zinc dust (nitrate free), light green (powder), pilocarpire nitrate reagent, rpmi media

CTN :39804397

31 Mar, 2025 NA

Ponnani - Kerala

Tender For supply of lab reagents - name of reagent/consumables with equipments, albumin for bs390, alkaline phosphatase for bs390, alkaline wash solution for bs390, aso for bs390, bilirubin total for bs390, bilirubin direct for bs390, calcium for bs390, cholesterol for bs390, crp for bs390, creatinine for bs390, hdl cholesterol for bs390, glucose hexokinase for bs390, ldl cholesterol for bs390, multicalibrator for bs390, phosphorus for bs390, ra for bs390, sgot for bs390, sgpt for bs390, total protein for bs390, triglycerides, urea uv for bs390, uric acid for bs390, qc norm for bs390, qcc path for bs390, crp for mispai2 ( 30 t), aso for mispai2 ( 30 t), ra for mispai2 (30 t), hbaic for mispai2 (15 t), capillary tube ( 100 nos), sodium conditioner for innolyte plus, weekly cleaning solution for innolyte plus, glucose for merilyser ( 1 ml), urea for merilyser ( 1 ml), creatinine for merilyser (1ml), sgpt for merilyser(1ml), cholesterol for merilyser(1ml), clot activator non vacum, vacutainer needle 22 g, k3 edta tube vacum, clot activator vacum, diluent for pe 6000(20 l), rinse/cleaner for pe 6000 (10l), lyse for pe 6000 (500ml), e-z cleaner for pe 6000 (100ml), probe cleaner for pe 6000(50 ml ), esr pipette for vesmatic 20, bilirubin total for merylyser(1 ml), bilirubin direct for merylyser (1ml), qc level 1 for mindray 900i, qc level 2 for mindray 900i, qc level 3 for mindray 900i, 3.8 % sodium citrate tube( vacum), dpx (250 ml), hitachi cup, anti a (10ml), anti ab (10ml), anti a1 h lectin (5ml), anti b (10 ml), anti d(10ml), anti d igg&igm(10ml), ahg(5ml), ayres spatula, barium chloride, bbr graph lab line, bbr pen lab line, capillary tube, clot activator tube, cover slip 18*18 mm( 1no), cover slip 22*22 mm(1no), cover slip 22*40 mm(1no), dengue igg,igm&ns1 combo card test, diamond pencil, disttiled water(5l), ea 36 (125 ml), esr pipette disposible, filter paper, filter paper sheet(ordinary), fouchets reagent, harris haematoxyline stain(500ml), hav igm card test, hcv card test, giemsa stain (125 ml), malaria pan pv pf, widal card test (double barrel whole blood), streptococcal rapid antigen (card test), 100 %isopropyl alcohol(5l), k3 edta tube non vacum, lancet, liss (250 ml), lepto igm card test, microtip large, micro tip small, micro scopic slide, micro centrifuge tube(500 nos), matrix gel card(144 t), og 6 (125 ml), peadiatric k 3 edta tube, pregnancy card, urine strip multiparameter, 3.8 % sodium citrate tube( non vacum), sodium flouride tube ( non vacum), sodium nitro prusside, sodium hypochlorate (2% 5l), sterile swab, sulphur powder, sulpho salycilic acid, spot band aid, tissue roll, test tube plastic (12*75), test tube glass ( 12*75), test tube brush, tourniquet belt, thermal paper (55 mm), urine container sterile, urine container non sterile, screw capped bottile, urine strip glucose protein, urine strip glucose ketone, viral transport medium ( vtm ), xylene ( 500 ml), vdrl card test, widal slide test (20ml), aso latex, ra latex, crp latex, hematology qc(bc5130), hbsag 0.3 ng sensitivity card test

State Government

CTN :39826251

10 Apr, 2025 50.00 Lacs

Kotdwar - Uttarakhand

Tender For lab reagents supply work at govt base hospital kotdwara - items articals for lab, binocular microscope with lens, electrolyte (na+,k+,ca+) pack, esr disposable westergren tube, esr stand wintrobe, esr stand westergren, spirit lamp, test tube rack (aluminium), slide box, hot air oven, incubator, stethoscope, blood pressure machine, physical balance &weight box, rh viewing box(electrical), photocaloriemeter, oil immersion lens 100x, stopwatch, timer, vdrl shaker with timer, semi auto analyser, antisera abd, acetone, acetic acid glacial, ammonia solution, ammonium sulphate powder, ammonium oxalate powder, auto pipette 5-50ul, benedicts solutionqualitative, benedicts solution quantitative, brush test tube, barium chloride 10%, conc . hcl, conc. h2so4, conc hno3, carbol fuchsin, test tube rack aluminium, high power lens 40x, low power lens, auto pipette 50-200ul, auto pipette 1000ul`, auto pipette 500ul, auto pipette 10ul, dropping bottle plastic 1000ml, neubaver counting chamber, disodium hydrogen phosphate, dropping bottle plastic125 ml, distilled water, eosin powder, edta powder, ethenol, eherlichs reagent, aec diluting fluid, edta vial, esr filling needle, fouchets reagent, filter paper, beaker plastic 100-1000ml, beaker glass 100-1000ml, centriguge tubes, glass test tube 12*75, glass test tube 12*100, glass cover slip, glass slide, glass capillary tube, glass haemoglobinometer, hb measuring tube 2-20%, glass pipette for hb 20ul, glass rbc pipette, glass wbc pipette, glass funnel, glass marking funnel, grams iodine, hydrogen peroxide, washing solution, pm kit (semi auto), am kit ( semi auto), glass cover slip, vacutainer vial red top, vacutainer vial, vaccutainer needles, aliquet 2ml, fluoride vials, sodium citrate vials, glass wbc pipette, glass funnel, dengue ns1ag/igm/igg card test, leishman stain, liquid paraffin, litmus paper red, litmus paper blue, methylene blue, multisticks for urine exam, malaria antigen card test, mountex ppd vial, n/10 hcl, pregnancy card test, typhoid dotigm/igg, vdrl card test, hbsag card test, hcv tridot, hiv tridot, urinometer glass, wintrobe esr tube, westergren esr tube, platelet diluting fluid, potassium oxalate, potassium dichromate, plastic washing bottle 250 ml, plastic stand, plastic funnel, pasteur pipette, potassium permagnate, printer roll/ paper, plane vial, edta vial, rubber bulb, rbc fluid, wbc fluid, sodium sulphate powder, sulphur powder, tips auto pipette white, tips auto pipette yellow, tips auto pipette yellow, semen diluting fluid, sodium hypochloride solution, tourniquette strong, tissue paper, uristicks for albumin sugar, urine collection pot disposable, wintrobe tube filler, xylene, liquor ammonia, acetone, aso latex slide test, raf latex slide test, crp latex slide test, rapid pap stain, diamond glass marker, gram stain, fnac plunger, ethanol, coverslip for fnac, mgg stain, gills haematoxylin stain, og / ea stain, 1% glacial acetic acid, wbc count fluid/ turk fluid, giemsa stain, spirit lamp, occult blood card test, water bath, thermameter

Monteleukast Tab Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government / Public Sector

Central Government/Public Sector

State Government