Tender For supply of ampicillin 10 mcg 5x50 disc catridge himidia make only , cloxacillin 5 mcg 5x50 disc catridge himidia make only , cefazolin 30 mcg 5x50 disc catridge himidia make only , cefatoxime 30 mcg 5x50 disc catridge himidia make only , cefpdoxime 30 mcg 5x50 disc catridge himidia make only , erythroumycin 15 mcg 5x50 disc catridge himidia make only , gentamycin 30 mcg 5x50 disc catridge himidia make only , nalidixic acid 30mcg 5x50 disc catridge himidia make only , ofloxacin 10 mcg 5x50 disc catridge himidia make only , amikacin 30 mcg 5x50 disc catridge himidia make only , vancomycin 30 mcg 5x50 disc catr himidia make only , tazoba/piper 10/100 mcg 5x50 disc catr himidia make only , augmentin 30 mcg 5x50 disc catridge himidia make only , cefuroxime 30 mcg 5x50 disc catridge himidia make only , lomefloxacin 10 mcg 5x50 disc catridge himidia make only , cefp/tazob10/100mcg 5x50 disc catr himidia make only , ciprofloxacin 5 mcg 5x50 disc catridge himidia make only , cephalexin 30 mcg 5x50 disc catridge himidia make only , ceftriaxone 30 mcg 5x50 disc catridge himidia make only , cotrimoxazole 25 mcg 5x50 disc catr himidia make only , nitrofurantoin 300 mcg 5x50 disc catr himidia make only , linezolid 30 mcg 5x50 disc catridge himidia make only , norfloxacin 10 mcg 5x50 disc catridge himidia make only , tetracycline 30 mcg 5x50 disc catridge himidia make only , azithromycin 15 mcg 5x50 disc catridge himidia make only , ceftazidime 30 mcg 5x50 disc catridge himidia make only , doxycycline 30 mcg 5x50 disc catridge himidia make only , levofloxacin 5 mcg 5x50 disc catridge himidia make only , meropenem 10 mcg 5x50 disc catridge himidia make only , amoxycillin 10 mcg 5x50 disc catridge himidia make only , chloramphenicol 30 mcg 5x50 disc catr himidia make only , cefixime 5 mcg 5x50 disc catridge himidia make only , penicillin 10u 5x50 disc catridge himidia make only , blood agar base 500 g. himidia make only , mac conkey agar 500gms himidia make only , glucose broth ( m860) 500g himidia make only , mueller hinton agar 500gms himidia make only , sterility testing medium a m017 500g himidia make only , agar agar ( grm 666) 500g himidia make only , robertson cooked meat medi m149 500g himidia make only , zn stain kit-himedia k005l (500 ml) , himidia make only , potassium permanganate himeda 500g himidia make only , formaldehyde solution 500ml himidia make only , inoculation loop ss4 metaloop la014 himidia make only , microtip stands (box with lid) 0-1000 l eppendorf make only , microtip stands (box with lid) 0-100 l eppendorf make only , autoclave t tube racks 30t tubes rack ria/ qualigens/ thermo fisher makes only , petri plates ria/ borosil/ sigma/ bello / abgil makes only , eto sterile swabs qualigens/ jonson/ thermo fisher/ himidia , makes only sterile containers , himidia/ borosil/ abgil makes only nutrient broth 500gms , himidia make only brain heart infusion agar 500gms , himidia make only mac conkey doub strength broth m539 500g , himidia make only fluid thioglycollate broth m009 500g , himidia make only sabouraud s dextr agar mediu mh063 500 , himidia make only anaerobic blood agar base med m1345 500 , himidia make only grams stain kit-himedia k001 (500 ml) , himidia make only lactophenol cotton blue () 125 ml , himidia make only barium chloride dehydrate 500g , himidia make only gelatin ( grm019) 500g , himidia make only nutrient agar ( m001) 500g himidia make only
Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76
Tender For corrigendum : supply of consumables for hydro generation plant and zds chemical - supply of consumables for hydro generation plant and zds chemicals to rgtpp, khedar, hisar, potassium hydroxide flakes (lr grade) in 10kg packing, vanadium penta oxide (v205) (lr grade), palladium catalyst 0.5% (on alumina base) 3-5 mm spheres, buffer solution ph-4.0, buffer solution ph-7.0, buffer solution ph-9.2, karl fisher reagent (hydranal coulomat ag), toluene rectified, methanol extra pure, oxalic acid dehydrate, potassium hydroxide pellets, hydrogen peroxide, citric acid, acetone, universal indicator, chlorotex reagent, methanol dried, sodium bicarbonate, sodium molybedate dehydrate, isopropyl alcohol, bottle wash ldpe plastic 500 ml, sample bottle plastic 500 ml tarson or polycab, sample bottle plastic 250 ml tarson or polycab, sample bottle plastic 1000 ml tarson or polycab, whatman filter papers 4.7 cmcategory no. 1440-047grade-40 to test mi (1 pack= 1000 nos. filter circles), chloroform bellow 500 ml (to collect sample of flue gases), volatile matter determination cooking crucible with projection with lid, h-38mm, d-25mm, infusil 2010 & 2025, sodium hypochlorite 8-10%, is 11673, ferric chloride anhydrous, is 711, sodium meta bisulphite, is 248, antiscalant acidic 100%, hydrated lime used for ph adjustment in raw water and neutralization of waste water as per is: 1540 (part-ii)-1990 or with latest amendment thereof (grade-a)