Muller Hinton Agar Tenders

Get complete information related to latest Muller Hinton Agar Tenders . from India at Classic Tenders. Search the best available tenders from Indian government tenders, domestic Muller Hinton Agar Tenders , private tenders, online tenders, tender invitation notice, business tender notices, online tenders and bidding Muller Hinton Agar Tenders .

Filter

Loading....

Get Tender in Email

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

State Government

CTN :39372273

01 Apr, 2025 1.54 Crore

Delhi - Delhi

Tender For corrigendum : rate contract for consumable/non-consumables items for microbiology department, rajiv gandhi super speciality hospital, delhi-110093 - dehydrated media, macconkey agarw/o cv, nacl w/ 0 .5% sodium taurocholate(500g/box), brain-heart infusion base(500g/box), blood agar base(500g/box), muller hinton agar base, cation adjusted(500g/box), colistin sulfate salt(1 gram), potassium dichromate(1 kg), peptone powder(500 gram), sulphuric acid(5 ltr), cled (cystein lactose electrolyte deficient)with bromothymol blue indicator(500g/box), peptone (bacteriological) water(500g/box), chromogenic candida agar(500g/box), sabouraud dextrose agar( sda)with chloramphenicol and cycloheximide antibiotics(500g/box), sabouraud dextrose agar( sda)without antibiotics(500g/box), macconkey broth purple with bromocresol purple(500g/box), macconkey broth purple (double strength) w/ bromocresol purple(500g/box), nutrient broth(500g/box), chrom candida differential agar(100 gm), mueller hinton broth with 2 control cations(100 gm), triple sugar iron agar(500gm), simmon s citrate agar(500gm), lab consumables, whatmann filter paper no.1, nichrome loop holderloop holder made of stainless steel rod with heat resistant handle, double wound nichrome loopcalibrated to 1 l, double wound nichrome loopcalibrated to 0.01 ml, double wound nichrome straight wire for inoculation, glassware, frosted end glass slide1. 75mm 25mm 1 mm2. thickness 1.25 0.1mm(1 box=50 slides), glass slide1. 75mm 25mm 2. thickness 1.25 0.1mm(1 packet of 10 grams), cover slip1. 22mmx22mm2. thickness: 0.13mm to 0.16mm(1 packet of 10 grams), test tubes(borosilicate glass) without rim 20mm 150mm, test tubes(borosilicate glass) without rim 12mm 75mm, conical flaskgood quality, flat bottom(500 ml), conical flaskgood quality, flat bottom (1000ml), glass measuring cylinder(100ml capacity), good quality petri dishplastic, disposable, sterile 90 15mm individual packed, glass beaker(500 ml capacity), glass beaker(250 ml capacity), glass measuring cylinder(250ml capacity), glass measuring cylinder(500ml capacity), reagent, carbol fuchsin (ziehl-neelsen)(125ml), 20% h2so4,(500 ml), conc. h2so4(500 ml), acetone(500 ml), crystol violet(25 gram), immersion oil for microscopy(125 ml), potassium hydroxide pellets(500g/box), oxidase discs(50 discs), stained salmonella antigen (to, th, ah, bh) with positive and negative controls for slide agglutination test, lugol s iodine(500 ml), kovac s indole reagent(100 ml), swab, sterile cotton swab with wooden stick1. size 150 x12mm diameter.2. individually packed. , sterile cotton swabs in hdpe tube1. cotton bud with polypropylene stick2. size:150x12mm diameter tubes3. individually packed, sterile swabs1. viscose bud with wooden stick2. size 150 x2.5mm3. individually packed ( gamma sterilized), plasticware, sterile disposable loop1. sterile disposable inoculating loops (4.4 mm diameter calibrated to 0.01ml)2. individually packed, micropipette tips 2-20 l, micropipette tips 20 -200 l, micropipette tips 200-2000 l, elisa plate(50 plates), centrifuge tubes(plastic, 15 ml capacity, screw caped, graduated), microcentrifuge tubeshould be 1.5ml, sterile, polypropylene tube with screw cap.(1.5ml), aerosol barrier tips 2-20 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 20-200 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., aerosol barrier tips 100-1000 lpolypropylene, gamma irradiated sterile and certified rnase/dnase free, human dna free and pyrogen free, aerosol resistant tips having a hydrophobic, self-sealing barriers., cryovialssterile self standing tight screw cap closures to prevent liquid leakage ,certified rnase/dnase free, human dna free and pyrogen free(2ml), antisera, salmonella polyvalen

Loading, Please wait...

Muller Hinton Agar Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government