Latest n dodecane Tenders | Government n dodecane Tenders

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39790845

02 Apr, 2025 10.80 Lacs

Mumbai - Maharashtra

Tender For tender enquiry for isopropyl alcohol ip ( 2 propanol)

CTN :39790870

02 Apr, 2025 7.95 Lacs

Mumbai - Maharashtra

Tender For tender enquiry for one propanol

State Government

CTN :39800642

27 Mar, 2025 NA

Multi City - Karnataka

Tender For 2 propanol ipa ip

State Government

CTN :39800643

27 Mar, 2025 NA

Multi City - Karnataka

Tender For 1 propanol

State Government

CTN :39699362

07 Apr, 2025 NA

Bhopal - Madhya Pradesh

Tender For supply of chemical item - 0.5m edta solution ph-8, mb grade, sterile, pack size-500ml, 1 m tris-hcl solution ph 8, mb grade, sterile, pack size-500ml, 20% sds solution, mb grade, sterile pack size-500ml, 5m sodium chloride solution, mb grade, sterile, pack size-500ml, 3m sodium acetate solution mb grade, pack size-500ml, proteinase-k(mb grade), 100mg pack size, dtt (mb grade), 25gm pack size, tris saturated phenol (mb grade), 500ml, chloroform (mb grade), 500ml pack size, isoamyl alcohol (mb grade), 500ml pack size, sodium acetate (mb grade), 500gm pack size, sodium chloride (mb grade) 500gm pack size, sds (mb grade) 500gm pack size, tris-hcl (mb grade) 500gm pack size, edta (mb grade) 500gm pack size, 2-propanol (mb grade), 1lit pack size, forensic buffer mb grade, sterile, pack size 500 ml, glacial acetic acid, mb grade, pack size 500 ml, sodium hydroxide, mb grade, 500gm pack size, glycerol, mb grade, pack size 500 ml, fta purification reagent, pack size 500 ml, hydrochloric acid, ultrapure, 500ml pack size, hand dis-infectant rub with 75% ethyl alcohol, skin softener and moisturizer, 500 ml pack size, sodium hypochlorite, 5 litre, pack size, surface sanitizer with 20% benzalkonium chloride, 0.5% cetrimide and 5 % isopropyl alcohol, 5 litre pack size, absolute alcohol ar grade, pack size-500ml, schiff s reagents ar grade, 500ml pack size, phosphate buffered saline ph 7.4, 50 tablet per pack, trimethylbenzene (tmb), pack size-25 gm, hydrogen peroxide 30% solution, pack size-500ml, haematoxylin (ehrlich) staining solution, pack size-125 ml, dpx mountant, pack size-500ml

CTN :39730641

08 Apr, 2025 NA

Ambala - Haryana

Tender For supply of tab daclatasvir 60mg , tab cyproheptadine 4mg , tab carbamazepine cr 200mg , tab rizatriptan 5mg , tab rifampicin 600mg plus isoniazid 300mg , ung clindamycin phosphate gel tube of 10gm , terbinafine 1 percent cream tube of 10gm , para dichlorbenzene 2 percent benzocaine 2 point 7 percent chlorbutol 5 percent turpentine oil 15 percent bott of 10ml , 2-propanol 45gm 1 propanol 30gm ethyl hexadecyl dimethyl ammonium ethyl sulphate 0 point 2gm with skin protecting substances 500 ml bott with dispenser , tab acetazolamide 250mg , pulv l ornithine l asparate pkt of 5gm , tab secnidazole 1gm , tab tacrolimus 0 point 5mg , acyclovir ophth ointment 3 percent w w in 5 gm tube , clotrimazole 1 percent plus lignocaine 2 percent bott of 10ml ear drop , salmeterol 25 mcg plus fluticasone 125 mg mdi 120 doses , tab lamivudine 150mg , ung clindamycin 1 percent adapalene 0 point 1 percent 15 gm , ung clobetasol propionate 0 point 05 percent plus salicyclic acid 3 percent 20gm , desonide 0 point 01 percent cream 10gm , ung eberconazole 30gm , ung moxifloxacin 0 point 5 percent for opthalmic use tube of 5 gm , ung polymycin b sulphate 5000units plus bactricin 400units plus neomycin sulphate3400units 20gm , ung tacrolimus 0 point 1 percent 10gm , lot chlorhexidine gluconate 4 percent bott of 500ml , lot clobetesal 0 point 05 percent salycyic acid 3 point 5 percent tube of 30ml , lot clotrimazole 1 percent plus beclomethasone 0 point 025 percent bott of 15 ml , lot lacquer nail amorlfine 5 percent 2 point 5ml , lot minoxidil 2 percent bott of 120ml , n acetyl cysteine nebulising solution 20 percent 5 ml , nasal spray azelastine 0 point 1 percent bott of 10ml , nasal spray mometasone 50 mcg puff 10 ml , pulv calcium polysterene sulphonate k binder sachet , pulv glutamine sachet , pulv l arginine sachet , pulv neomycin plus polymixin b bott 10gm , pulv pre probiotic , syp disodium hydrogen citrate bott of 100ml , syp ibuprofen plus paracetamol bott of 60ml , tab acarbose 25mg , tab acelofenac plus paracetamol plus chlorxazone , tab acenocoumarole 2mg , tab acotiamide 100mg , tab alprazolam 0 point 5mg , tab amisulpride 50mg

CTN :39731171

08 Apr, 2025 11.42 Lacs

Nashik - Maharashtra

Tender For supply of paracetamol with cysteine hcl monohydrate infusion 1000mg 100ml , paracetamol 10 mg ml infusion in 100 ml bottle , 2 propanol 45 gm 1 propanol 30 gm ethyl hexadecyl dimethyl ammonium , hydrogen peroxide solution with snoilizer ip 20 volume 500 ml bott , levonorgestrel 0dot25 mg plus ethinylestradiol 0dot03mg pack of 21 no , hand gloves size 6 1 2 pair of , hand gloves size 7 pair of , hand gloves size 7 1 2 pair of , adhesive plaster zinc oxide 2dot5 cm x 1 mtr , adhesive plaster zinc oxide 7dot5 cm x 5 mtr , adhesive plaster micro porous tape 2 inches box of 6 , adhesive plaster micro porous tape 3 inches box of 4 , bandage crepe 10 cm , bandage crepe 15 cm , bandage elastic adhesive 6 cm x 3 metres unstretched and 5 6 , cotton wool absorbent pkt of 50 gm , cotton wool absorbent pkt of 500 gm , cotton wool non absorbent pkt of 500 gm , dressing medicated gauze paraffin 10 cm x 10 cm tin of 24 , dressing sterile 8 x 8 box of 3 , gauze surgical open woven unmedicated 60 cm wide , gauze surgical open woven unmedicated 60 cm x 3 metres packet , monofilament polyglyconate synthetic absorbable suture size 3 0 70 75 cm 1 2 , semi auto analyser wash solution for , drabkin solution diluting solution for haemoglobin estimation ny , keto diastix bott of 50 strips , strips albumin and glucose bott of 100 strips , antiseptic solution bott of 500 ml savlon , glucose solution 5percent in non toxic disposable plastic bott of 500ml ffs d5 , glucose saline isotonic solution self collapsible container dextrose 5percent , sodium chloride solution isotonic sin non toxic disposable plastic bott 500 ml , ecg roll chemical coated size 215mmx20mtr , accuchek glucometer strips bott of 50 strips , anti microbial hand wash , diclofenac diethylamine bp2dot32percent methyl salicylate i p , ecg paper roll 215mm x 20 mts , normal saline 100 ml , protein powder diabeties care 400 gm , spirit 400 ml , stocking half size large , glyseb soap , phenol soution 500 ml , chlorhexidine solution dettol 5 lit , d 5 iv 500 ml , ns iv 500 ml , roller bandage 10 cm , roller bandage 6 cm , adhesive plaster micro porous tape 1 inch box of 12 , sterile adhesive dressing 10 x 8 cm pkt , baid aid , gauze sterile , bandage abdominal binder with perineal support medium , catherer foleys silicon 2 way 5 ml size 16 fg , syringe disposable plastic sterile 2 ml with needle , syringe disposable plastic sterile 5 ml with needle , syringe dosposable plastic sterile 10 ml with needle , insulin disposable syringe 100 iu 1 ml , vaccum blood collection tubes without needles edta 3 ml , vaccum blood collection tubes without needles sterile tube with , vaccum blood collection tubes without needles sterile tube without gel 5ml , vaccum blood collection tubes without needles sodium citrate 3ml , vaccum blood collection tubes without needles and additives , arm sling pouch l , arm sling pouch m , arm sling pouch paediatric , knee cap elastic medium , knee cap elastic small , elastoplast , neoprene anklet size s m l xl , heel cushion , ls belt large , walking stick monopod , abdominal binder 10 , bandage open woven compressed 2dot5 cm x 4 metres , bandage open woven uncompressed 6 cm x 4 metres , bandage open woven uncompressed 10 cm x 4 metres , bandage triangular , bandage abdominal binder with perineal support large , bandage dvt stocking small , bandage dvt stocking medium , bandage dvt stocking large , dressing medicated adhesive 2dot5 cm x 6 cm in a single strip pack baind aid , gauze absorbent folded 2dot5 cm x 100 metres , surgeons mask disposable , n95 face mask , cannula iv with injection port and wings size 20g , cannula iv with injection port and wings size 22g , cannula iv with injection port and wings size 24g , microtips 200ul filter barrier and sterile , microtips 1000ul filter barrier and sterile , sodium chloride solution 0dot9percent non toxic plastic bottle of 100 ml , lancet disposable pre sterilised s10 , scalp vein set with luer fitting of disposable plastic siz

CTN :39711578

05 Apr, 2025 18.99 Lacs

Leh - Jammu And Kashmir

Tender For tender for supply of sodium hypochloride 5 percent , chlorhexidine gluconate sol equivt to 4 perc w by v with isopropanol smaller than 10 perc ethoxylate alkylphenol smaller than 10 perc fatty acid diethanolamide smaller than 10 perc acid glacial , 60 perc v by v ethyl alcohol with benzaconium chloride glycer dimethicon cyclopenta c 12 to 15 alkyl methylparaben phenoxythanol stearyl alcohol aminomethyl propanol diazolidinyl urea , 0 point 5 percent w by v chlorhexidine gluconate in 70 percent v by v ethyl alcohol with moisturizer 500 ml bott with dispenser , 1 percent w by v available iodine in non oxynoi iodine surfactant base 500 ml bott , 10 percent povidone iodine sol usp equivqlent to 1 percent available iodine 500 ml bott , alcohol free 2 percentsaturated chlorhexidine gluconate clothin a non alkaline base 15 to 20 cm in to 15 to 20 cm size , chlorhexidine sol containing chlorhexidine gluconate bp 7 point 5 percent v by v cetrimide bp 15 percent w by v 500 ml bott