Latest nitric acid Tenders | Government nitric acid Tenders

Central Government/Public Sector

CTN :39541968

29 Mar, 2025 6.00 Lacs

Bhopal - Madhya Pradesh

Tender For bid to ras supply of chemicals for soil analysis - ammonium molybdate tetrahydrate , orthophosphoric acid abt , sulfuric acid , activated charcoal , buffer capsule ph 4.0 colour of solution orange , buffer capsule, ph 7.0 colour of solution green , buffer capsule, ph 9.2 colour of solution blue , devarda alloy , edta calcium disodium salt , antimony potassium tartrate trihydrate , hydrogen peroxide , methyl red indicator solution , oxalic acid dihydrate , sodium acetate trihydrate , potassium hydroxide pellets , sodium bicarbonate , potassium dichromate , methanol , ammonium fluoride , ammonium chloride , nitric acid 69 72 perc pure , ferrous ammonium sulphate hexahydrate , ammonium acetate , nitric acid , perchloric acid , hydrofluoric acid , phenolphthalein indicator , diethylene triamine penta acetic acid dtpa , ethelynediamine tetra acetic acid , devardas alloy , fluorescein diacetate , potassium dihydrogen phosphate , triphenyl tetrazolium chloride ttc , 1 3 5 triphenyltetrazolium formazan , sodium bi carbonate , sodium chloride , potassium sodium tartrate tetrahydrate also known as rochelle salt , hydrochloric acid , calcium chloride , sodium thiosulphate , acetic acid , activated charcoal phosphorus free , ammonium metavanadate , ammonium molybdate , barium chloride , boric acid , calcon indicator , copper sulphate , ebt indicator , ferrous ammonium sulphate , gum accasia , l ascorbic acid , murexide , orthophosphoric acid , potassium permanganate , potassium sulphate , selenium metal powder , sodium hexa meta phosphate , sodium hydroxide pellets , sodium acetate , ammonium hydrogen carbonate , maleic acid , citric acid , oxalic acid , potassium dihydrogen orthophosphate anhydrous , methyl orange indicator , methyl red indicator , malic acid , gum acacia powder , guar gum powder , potassium dicromate , potassium cloride , ammonium metavandate , concentrated sulfuric acid , orthoposphoric acid , ferrous ammonium sulphote , potossium permangnate , sodium hydroxide , methyl red , bromocresol green , azomethine , standard hydrochloric acid , sodium bicorbonate , dargo g 60 activate charcol , ammonium paramolybdate , antimony potassium tartrate , ascorbic acid , potassium dihydrogen orthophocphate , calcium cloride , magnesium cloride , potassium nitrate , gum acacia , dtpa diethylenetriamine penta acitic acid , tea triethonol amine , buffer tablet ph 4.0 7.0 9.2 , microplate , ethanol

Central Government/Public Sector

CTN :39562351

07 Apr, 2025 NA

Roorkee - Uttarakhand

Tender For corrigendum : supply of various chemicals-, mercuric sphate , silver sulphate (ag/504) (258) , ammonium chloride (nh) (500g) , magnesium sulfate (mgso) (500g) , calcium chloride (cac) (500g) , nesslers reagent (100m) , potassium persulfate (,50%) (500g) , ammonium molybdate (100g) , stannus chloride (snc12) (100g) , glycerol (500m , calcium carbonate (caco) (500g) , cobalt chloride cocl2 (100g) , zinc chloride zn2(500) , nickel chiaride nic12 (500g) , manganese sulphate ms04 (500g) , sodium selenite na2seo3-5h20(25) , sodium tungstate dihydrate na2wo4-2h20(100g) , sulfanlic acid (5g) , n-(2-naphthyl)-ethylenediamine dihydrochloride (ned) (5) , hydrochloric acid (500 ml) , nitric acid (500 ml) , sulphuric acid (2.5l) , anthrone (100 , standard glucose (500g) , copper sulphate tetrahydrate (500g) , potassium hydrogen tartarate (500g) , na (500g) , cod call test (range 100-1500mg/(25/pack) , reagent bottle screw cap 500ml , hplc vail 2 ml transparent (paket of 1001 , hplc vail 2 ml amber colour (pallet of 1001 , silica crucilbel (25 ml) , beaker (100m) , reagent bottle (100 ml) , chemical weighing bottle (25-50 ml) , quartz cuvette , carboy (101) , glass slides (pack of 50) , cover slips (pack of 100) , membrane filter nylon (0.45m) (pack of 1001 , silicone rubber septum seals gl 45 (pack of 100),

CTN :39820811

09 Apr, 2025 1.00 Crore

Palakkad - Kerala

Tender For supply of dialysis consumables - nephrology unit, dialysis centre, acid concentrate solution for bicarbonate haemodailysis, acid concentrate solution high potassium for bicarbonate haemodailysis, acid concentrate solution with out potassium for bicarbonate haemodailysis, sodium bicarbonate and sodium cloride powder for bicarbonate haemodailysis, dextrose powder for bicarbonate hemodialysis, single use dialyser for haemodialysis, single use dialyser for haemodailysis, single use dialyser for haemodailysis, blood tubings for haemodailysis-single use, av fistula needle haemodailysis 15g, av fistula needle haemodailysis 16 g, av fistula needle haemodailysis 17 g, renaclean cold sterilant, ctrix la citric mallic and lactic acid, citric acid powder, sodium hypochlorate (bleech), chlorine tablets, transducer protector, dialysis starting kit, wounded jumbo water filter 5 microns, wounded catridge filter uv 5 microns, wounded catridge filter uv 5 microns, pyrogen filter for uv, antiscalant, double lumer catheter for haemodialysis straight adult, 11.5 fr, double lumer catheter for haemodialysis curved adult -11.5fr, accute peritoneal dialysis catheter-adult, accute peritoneal dialysis catheter-pediatric, y connection set for peritoneal dialysis, accute peritoneal dialysis fluid 1.7%, capd catheter with percutaneous introduction set- swan neck coilied, capd catheter with percutaneous introduction set- straight, peritoneal dialysis fluid 1.5% (capd), peritoneal dialysis fluid 2.5% (capd), peritoneal dialysis fluid 7.5% (capd), minicap for capd catheter, diasafe dialysate fluid filter for haemodialysis machines, capd fluid for pd cycler 1.5%, capd fluid for pd cycler 2.5%, starting cassette for automatic pd cycler, minicap extended capd transfer with twist clamp, titanium adapter for capd, kidney biopsy gun, kidney biopsy gun, sodium meta bisulphate powder, kitchen salt, plasma filter for plasmapheresis, powdered acid concentrate for haemodialysis( citrate dialysate), empty bag, equipment cleaning solution

CTN :39826378

28 Mar, 2025 NA

Nalbari - Assam

Tender For supply of consumables in the laboratory of swahid smriti mahavidyalaya - services, tween 20, bovine serum albumin bsa, dimethyl sulphoxide dmso, citric acid monohydrate, amicon 10 kda mwco filter 15 ml sample, ammonium persulphate aps, mouse neuron specific enolase elisa kit, mouse s100b elisa kit, acetone, trichloroacetic acid tca, ethylenediaminetetraacetic acid edta, protein marker mbt092 10 ln, 5 ml hitrap q hp anion exchange column cytiva, mouse interlukin 1b elisa kit, mouse anti neun antibody, goat anti mouse igg1 alexa fluor 488, mouse anti map2 antibody, goat anti mouse igg2a/b alexa fluor 594, fab anti mouse igg fragment, mouse anti synaptophysin antibody, goat anti-mouse igg alexa fluor 488

Central Government/Public Sector

CTN :39832431

31 Mar, 2025 NA

Mumbai - Maharashtra

Tender For supply of 5172 mt nitric acid (58 percent - 61.5 percent concentration)

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

corporations/Associations/Others

CTN :39835334

16 Apr, 2025 6.00 Lacs

Faridabad - Haryana

Tender For supply of phenolphathalein , o toludine , malachite green , sodium perborate tetrahydrate , glacial acetic acid , distilled water , benzidine hydrochloride sol , 3 aminophthal hydrazide , sodium hydroxide flakes , pyridine , dextrose , sodium chloride , 12 panel drub abuse kit , grams iodine , potassium iodide , picric acid , sodium alpha naphthyl phosphate , fastblue salt , potassium dichromate , sulphuric acid , dragondorfs reagent , nesslers reagent , schiffs reagent , sodium nitroprusside , acetone , mercurous nitrate , vanillin reagent , formaldehyde , furfuraldehyde , cobalt thiocyante , 4 dimethylamino benzaldehyde , nitric acid fuming , ferrous sulphate , sodium picrate , 3355 tetrabromophenolphthalein ethyl ester , ferric chloride , folin and ciocalteus phenol reagent , millons reagent , p dimethylaminobenzaldehyde , portable breath alcohol analyzer

CTN :39836531

09 Apr, 2025 NA

Mumbai - Maharashtra

Tender For supply of citric acid monohydrate (ongc) (q3)

CTN :39846515

17 Apr, 2025 NA

Kalpakkam - Tamil Nadu

Tender For supply of item 1 - ultra pure nitric acid 67 - 69% as tech spec annex attached , item 2 - suprapur hydrochloric acid 35 - 37% as tech spec annex attached

CTN :39816374

15 Apr, 2025 NA

Dehradune - Uttarakhand

Tender For supply of acid nitric ip technical grade special gravity 1 point 4 , nitric acid chemically pure grade to is 264 by1976 specialgravity 1point42 , acid hydrofloric 60 to 80 percent pure sp grade 0 point 98 at 13 point 6 deg centigrade , acid hydrochloric pure 1point 18 lr grade confirming is 265 by 1976 sp , acid sulphuric 20 percent sp grade 1 point 1394 at 20 degre centigrade , acid sulphuric pure sp grade 1 point 84 make glaxo ranbaxy , copper sulphate lr grade make glaxo ranbaxy e merck sds qualigens

Nitric Acid Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

Central Government/Public Sector

corporations/Associations/Others