Latest nitrofurazone cream Tenders | Government nitrofurazone cream Tenders

State Government

CTN :39840245

29 Mar, 2025 50.00 Lacs

Dausa - Rajasthan

Tender For single sourse rate contract-, ada, , ada cali, , ada controls, , albumin, , albuminsmall system pack, , alkaline phosphatase, , alkaline phosphatase small system pack, , alkaline phosphatase, , amylase, , amylasesmall system pack, , bilirubin direct, , bilirubin direct small system pack, , bilirubin direct plus (dca), , bilirubin total, , bilirubin total small system pack, , bilirubin total plus (dca), , calcium (a), , calcium (a), , calcium (a) small system pack, , chloride, , cholesterol, , cholesterol small system pack, , ck mb, , ck mb small system pack, , ck nac, , ck nacsmall system pack, , control h (aso/rf/crp), , control l (aso/rf/crp), , creatinine - enzymatic, , creatinine - enzymatic, , creatinine - jaffe, , erba autowash - system pack, , four norm, , four norm, , erba path, , erba path, , fe 125, , ferritin, , ferritin calibrator, , ferritin control low, , ferritin control high, , gamma gt, , gamma gtsmall system pack, , glucose (god - pod), , glucose hexokinase - uv, , hba1c cali set, , hba1c con h, , hba1c con l, , hdl cholesterol with calibrator, , ldh - p, , ldh - psmall system pack, , ldl cholesterol with calibrator, , lipase xl, , lipase xl small system pack, , magnesium, , micro albumin control, , micro albumin with cal, , microprotein with cal, , microprotein with cal small system pack, , phosphorus, , phosphorus small system pack, , sgot - the, , sgot - the mini, , sgot-hl, , sgot-hl small system pack, , sgpt-el, , sgpt - el mini, , sgpt - hl, , sgpt-hl small system pack, , total protein, , total protein (two reagents), , total proteinsmall system pack, , triglycerides, , triglycerides - small system pack, , uibc 125, , urea, , urea small system pack, , uric acid, , uric acid small system pack, , xl - aso - turbilatex with calibrator (ita), , xl-autowash ac/al kit, , xl - multical, , xl-rf-turbilatex with calibrator (ita), , xl-rf-turbilatex with calibrator (ita), , xl-crp-turbilatex with calibrator (ita), , xl hba1c with cali set, , sample cup, , , , , , , , , , , , , , , , , , , , , , , , , ,

CTN :39858886

18 Apr, 2025 10.65 Lacs

Ferozepur - Punjab

Tender For supply of acebrophyllin 100mg acetycstine 600mg pulmoclear tab , acetaminophen 325 mg plus tramadol 37.5 mg ultracet tab , alovera and vitamin e lotion , alprazolam 0.5 mg tab , amitriptyline 10 mg tab , aripiprazole 5 mg tab , aspirin 75 mg plus atorvastatin 10 mg plus clopidogril 75 mg tab , aspirin 75 mg plus atorvastatin 20 mg plus clopidogril 75 mg tab , asthalin respules levolin resp , azelasartan 40 mg tab , baclofen 20 mg tab , betahistine 24 mg tab , brivaracetam 100mg tab , calcium vit d3 syp 200ml bott , calcium carbonate plus calcitirol plus methulcobalamin plus vitamin k2 and zinc tab , capesitabine 400mg plus cyclophosphamide 20mg tab , carbamazepine 200 mg cr tab , cefuroxime 500mg plus clavuclonic acid 125 mg tab , chlordiazepoxide 5 mg plus clidinium bromide 2.5 mg , chlorhexidine mouthwash 2 perc bottle of 150 ml , cilinidium plus chlordiazepoxide plus dicyclomine tab , cinitapride 3mg plus pantoprazole 40mg tab , clarithromycin 250mg tab , clobetasol plus gentamicin oint , clonazepam 2 mg tab , clopidogrel 75 mg plus aspirin 75 mg tab , clozapine 100 mg tab , coenzyme q10 100 mg tab , coenzyme q300 mg tab , collagen peptide plus hyaluronate tab , combipack of amoxicillin 750mg plus tinidazole 500 mg plus omeprazole 20 mg hp kit , daflon 500mg diosmin 450mg plus hesperidin 50mg tab , dapagliflozin 10 mg plus metformin 500 mg tab , dienogest 2mg tab , disodium hydrogen citrate syrup , donepezil 5mg plus memantine 10mg tab , drotaverine hcl 40 mg tab , ed bimatoprost 0.01 perc , ed nepafenac 0.1perc w v , ed olopatadine plus ketorolac bott of 10ml , ed potassium iodide sodium chloride and calcium chloride calodin 5 ml , ed travaprost plus timolol bott of 10ml , enteral feed powder protein 85 perc short chain peptides 15perc free amino acids fat 50 perc mct 25 perc vet fat carbohydrate malto destri sht of 126gm , eperisone 50 mg tab , escitalopram 5 mg plus clonazepam 0.5 mg , escitalopram 5 mg plus clonazepam 0.5 mg tab , evening primarose 1000 cap , fenofibrate 200mg plus atorvastatin 10mg tab , flupentixol 0.5 mg plus melitracen 10 mg tab , flurbiprofen 0.03 perc eye drop , fungal diastace plus papaine plus activated charcol unienzyme , ginkgo biloba tab , glimepiride 2mg metformin 500mg tab , glimepiride 2 mg plus metformin 500 mg sustained release tab , glucose powder , heparin 15g 20g oint , human insulin analogue aspart premix 30 per insulin 70 per insulin protamine aspart suspension 100 iu ml 3 ml pfs , hydrochlorothiazide 12.5 mg tab , indapamide 1.5mg tab , inh beclomethason 200mcg 200 meter dose inh , inh salmeterol 25mcg plus fluticasone 125mcg 120 mdi , inh triohale tiotropium bromide 9 mcg plus formoterol 6 mg plus ciclesonide 200mcg 200 meter dose inh , inj degludec insulin aspart ryzodeg , inj filgrastim 300 mcg , inj human mixtard 30-70 , inj insulin liraglutide 6mg ml 18mg pen , insulin humalog lispro inj recombinan dna origin 100iu mlcartidge , isosorbid 5 mg monontrate 30 mg tab , isosorbid mononitrate 10 mg tab , isosorbide dinitrate 5 mg tab , ketoconazole shampoo , ketoralac 0.2 perc e d , l carnitine 500mg tab , levocarnitine 500 mg tab , lignocain plus gabapentin oint , linagliptin 5 mg plus empagliflozin 10 mg tab , liq paraffin 100 ml bott , losartan 50mg plus hydrochlorthiazide 12.5mg tab , memantine 5 mg plus donepezil 5 mg tab , mesalamine 400 gm tab , metolazone 2.5 mg tab , metoprolol xl 12.5 mg tab , midodrine 10mg tab , minoxidil 5 perc w v lotion 60 ml , mirabegron 25mg plus solifenacin 5mg tab , mirtazapine 7.5 mg tab , montelukast plus bid details/ 2 / 152 levocetrizine plus acebrophylline 200mg tab , multivitamin plus multimineral tab , multivitamin syp , nandrolone deconate 50 mg inj , nasal spray calcitonin 200iu , nepafenac 0.3 perc w v5 ml ed , nifedipine retard 10 mg tab , nitroglycerin 2.6 mgtab , omega 3 fatty acid cap , omega fatty acid plus antioxidant cap , powder clotrimazole 75 gm , propranol 40 mg tab , rabeprazole 20 mg plus levosulpride 75mg tab , rabeprazole

Central Government/Public Sector

CTN :39848366

09 Apr, 2025 NA

Kapurthala - Punjab

Tender For supply of glucose kit pap 12 x20ml

State Government

CTN :39827482

02 Apr, 2025 NA

Varanasi - Uttar Pradesh

Tender For supply of reagents and consumables for abl 800 flex radiometer on rate contract basis - preventive maintaince kit for abl800 flex radiometer, d11 reference memberane 1 box (4 units), d733 calcuim memberane 1 box (4 units), d744 chloride memberane 1 box (4 units), d755 sodium memberane 1 box (4 units), d788 pco2 memberane 1 box (4 units), d799 po2 memberane 1 box (4 units), d7066 po2 glucose memberane 1 box (4 units), d7077 lactate memberane 1 box (4 units), s7770 thb cal solutions, s8375 cleaning solutions, s1820 caliberation solutions 1, s1820 caliberation solutions 2, s4980 rinse solutions, caliberation gas 1 34 bar, caliberation gas 2 34 bar, d722 potassium memeberane 1 box (4 units), s5 362 hypochloride solution for protein removal for decontaminations

CTN :39828784

03 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of ampicillin 10 mcg 5x50 disc catridge himidia make only , cloxacillin 5 mcg 5x50 disc catridge himidia make only , cefazolin 30 mcg 5x50 disc catridge himidia make only , cefatoxime 30 mcg 5x50 disc catridge himidia make only , cefpdoxime 30 mcg 5x50 disc catridge himidia make only , erythroumycin 15 mcg 5x50 disc catridge himidia make only , gentamycin 30 mcg 5x50 disc catridge himidia make only , nalidixic acid 30mcg 5x50 disc catridge himidia make only , ofloxacin 10 mcg 5x50 disc catridge himidia make only , amikacin 30 mcg 5x50 disc catridge himidia make only , vancomycin 30 mcg 5x50 disc catr himidia make only , tazoba/piper 10/100 mcg 5x50 disc catr himidia make only , augmentin 30 mcg 5x50 disc catridge himidia make only , cefuroxime 30 mcg 5x50 disc catridge himidia make only , lomefloxacin 10 mcg 5x50 disc catridge himidia make only , cefp/tazob10/100mcg 5x50 disc catr himidia make only , ciprofloxacin 5 mcg 5x50 disc catridge himidia make only , cephalexin 30 mcg 5x50 disc catridge himidia make only , ceftriaxone 30 mcg 5x50 disc catridge himidia make only , cotrimoxazole 25 mcg 5x50 disc catr himidia make only , nitrofurantoin 300 mcg 5x50 disc catr himidia make only , linezolid 30 mcg 5x50 disc catridge himidia make only , norfloxacin 10 mcg 5x50 disc catridge himidia make only , tetracycline 30 mcg 5x50 disc catridge himidia make only , azithromycin 15 mcg 5x50 disc catridge himidia make only , ceftazidime 30 mcg 5x50 disc catridge himidia make only , doxycycline 30 mcg 5x50 disc catridge himidia make only , levofloxacin 5 mcg 5x50 disc catridge himidia make only , meropenem 10 mcg 5x50 disc catridge himidia make only , amoxycillin 10 mcg 5x50 disc catridge himidia make only , chloramphenicol 30 mcg 5x50 disc catr himidia make only , cefixime 5 mcg 5x50 disc catridge himidia make only , penicillin 10u 5x50 disc catridge himidia make only , blood agar base 500 g. himidia make only , mac conkey agar 500gms himidia make only , glucose broth ( m860) 500g himidia make only , mueller hinton agar 500gms himidia make only , sterility testing medium a m017 500g himidia make only , agar agar ( grm 666) 500g himidia make only , robertson cooked meat medi m149 500g himidia make only , zn stain kit-himedia k005l (500 ml) , himidia make only , potassium permanganate himeda 500g himidia make only , formaldehyde solution 500ml himidia make only , inoculation loop ss4 metaloop la014 himidia make only , microtip stands (box with lid) 0-1000 l eppendorf make only , microtip stands (box with lid) 0-100 l eppendorf make only , autoclave t tube racks 30t tubes rack ria/ qualigens/ thermo fisher makes only , petri plates ria/ borosil/ sigma/ bello / abgil makes only , eto sterile swabs qualigens/ jonson/ thermo fisher/ himidia , makes only sterile containers , himidia/ borosil/ abgil makes only nutrient broth 500gms , himidia make only brain heart infusion agar 500gms , himidia make only mac conkey doub strength broth m539 500g , himidia make only fluid thioglycollate broth m009 500g , himidia make only sabouraud s dextr agar mediu mh063 500 , himidia make only anaerobic blood agar base med m1345 500 , himidia make only grams stain kit-himedia k001 (500 ml) , himidia make only lactophenol cotton blue () 125 ml , himidia make only barium chloride dehydrate 500g , himidia make only gelatin ( grm019) 500g , himidia make only nutrient agar ( m001) 500g himidia make only

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

CTN :39816393

15 Apr, 2025 NA

Amritsar - Punjab

Tender For supply of calcium kit , esr disposable pipette , gluco strip one touch , ketostick bott of 100 strip , albumin kit , alkaline phosphatase kit , protein kit , plastic tube riya vial , r.a factor kit of 20 test , syringe disposable plastic 2ml with needle , syringe disposable plastic 5ml with needle , uniplastin pt-inr , urea kit , uric acid kit , uristick bott of 100 strip , sgot kit , sgpt kit , widal kit , distilled water can of 5 ltr , cholesterol kit , creatinine kit , glucose kit , bilirubin kit , micro cover glass , crp kit , lancet pricking needle , urine container

CTN :39322122

28 Mar, 2025 NA

Bhopal - Madhya Pradesh

Tender For bid to ras corrigendum : procurment of lab reagents - cled agar , kit for estimation of cpk , prothrombin time reagents , pttk reagent , occult blood test , d dimer ichroma , kit for estimation of cpk-mb , pt reagent , biofix cytofix spray , pa colifrom kit , snap pack for eletrolyte analyser , kit for csf microprotien , transasia erba h360 control , transasia erba h360 calibrator , transasia erba h360 elit h clean , transasia erba h360 lyse , transasia erba h360 dil , haematology 5 part h560 lyse 1 , haematology 5 part h560 lyse 2 , heamatology 5 part h560 diluent 1 , transasia erba h560 control , combi disk gn1 abst , combi disk gn2 abst , combi disk gp1 abst , erba wash kit , uristix albumin and glucose , surgical spirit , band aid , kit for lipase , microscope lens cleaning solution , haematoxylin and eosin stain , pencil marking glass , hba1c fully automated em 200 xl system pack , ckmb fully automated em 200 xl system , anti hev , ldh fully automated em 200 xl system pack , ada fully automated em 200 xl system pack , erba norm kit fully automated em 200 xl system pack , erba path kit fully automated em 200 xl system , xl multical fully automated em 200 xl system pack , mac conkey broth powder , micro albumin , micro protein , cytochrome stain kit , erba auto wash , erba auto wash fully automated , anti hav

Central Government/Public Sector

CTN :39335480

28 Mar, 2025 NA

Delhi - Delhi

Tender For bid to ras supply of alp (4* 35+ 2* 18ml) , bilirubin total dsa (4* 20+ 1* 20) , urea (4* 35+ 2* 18) , creatinine (2x27+ 1x18ml) , uric acid kit 4* 40+ 2* 20ml , hba1c kit (1x40+ 1x15+ 1x200+ 2x1ml calibrator) , calcium (4* 40ml) kit , amylase kit 1* 38+ 1* 10 , specific protains calibrators (1 ml) , lipids calibrator 1ml , alt0102 (sgpt) , ast0102(sgot) , glucose kit god pod method (mr) , total cholesterol kit , triglycerides kit , hdl cholesterol kit

CTN :39357843

28 Mar, 2025 NA

Ranchi - Jharkhand

Tender For bid to ras tender for supply of zidovudine 300mg plus lamivudine 150mg plus nevirapine 200mg tab , nitrofurantoin 100 mg tab , tab thyroxin sodium 75 mcg , inj nitroglycerineoblique glyceryltrinitrate 5 mg , syp zinc 20 mgoblique 5 mlcoma bottle of 100 ml , dexamethasone 4 mg , tab dienogest ip 2 mg , inj leuprolide 3point75 mg , bisoprolol 2point5 mg tab , carvediolol 6point25 mg tab , propranolol 10 mg tab , trimetazidine 20 mg tab , misoprostol 200 mcg tab , prednisolone 10 mg tab , voglibose 0point3 mg tab , hepatitis b vaccine 10 ml , inj hepatitis b immunoglobin 100iuoblique1ml , tetanus toxoidcoma purified absorbed rubber cappedcoma vial of 5 ml , alprazolam 0point5 mg tab , cilnidipine 10 mg tab , clobazam 10 mg tab , deflazacort 12 mg tab , deflazacort 30 mg tab , entecavir 1 mg tab , ethambutol 1 gm tab , etoricoxib 60 mg tab , gabapentin 100 mg tab , hydrochlorothiazide 12point5 mg tab , lacosamide 50 mg tab , lorazepam 2 mg tab , methylcobalamin 500 mg tab , metoprolol 25 mg tab , mouth ulcer gel tube of 10 gm , naproxen 500 mg tab , paracetamol suppositories 150 mg , piracetam 800 mg tab , rosuvastatin 20 mg tab , serratiopeptidase 10 mg tab , serratiopeptidase 5 mg tab , sodium valproate 500 mg cr tab , telmisartan 20 mg tab , vitamin e 400 mg cap , inj phenytoin sodium 50 mgobliquemlcoma 2ml ampoule , inj clindamycin 600 mg , iron sucrose 20mg inj vial of 1 ml , inj mephentermine inj mephentine , vitamin d3 400 iu cholecalciferol drops bottle of 15ml , vitamin d3 800 iu cholecalciferol drops bottle of 15ml , inj phytomenadione vitamin k 10 mgobliqueml , ddes125 solution , tab tadalafil 20mg , tab ambrisertan 5mg , polyethylene glycol sachet 7 grams , syp calcium with phosphorus calcium 82plusphosphorus 41mgoblique5ml , vigabatrin powder for oral solution usp 500 mg sachet , surgical suction with vaccum tube and yankauer nozzle , adult diapers pkt of 10 size smallcoma medium and large assorted size , vac gel foam dressing size small with canister , vac gel foam dressing size medium with canister , colostomy kit with accessories , colostomy kit with belt care paste base cover tube , one touch select glucose strips bott of 50 strips , single foiled beta ketone strips 10 strips per box compatible optium neo h blood

Nitrofurazone Cream Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

State Government

Central Government/Public Sector

State Government

Central Government/Public Sector

Central Government/Public Sector