Latest nutrient Tenders | Government nutrient Tenders

CTN :39972669

17 Apr, 2025 NA

Bardhaman - West Bengal

Tender For quotation for nutrient agar medium (any standard company), nutrient broth (any standard company), hicrome candida differential agar (any standard company) and corn meal agar (any standard company)

CTN :39738135

17 Apr, 2025 NA

Tinsukia - Assam

Tender For supply of essential materials/food stuffs/cattle feed to be used as gr to the flood affected families during 2025-26 - food stuff, rice, masoor dal (medium), arahar dal, salt (pkt), m.oil, chira, gur, potato, onion, biscuit (200gm/100gm), bread, baby food, milk powder (appropriate to the age group of 6 months to 3 years of reputed brand, ready to eat (micro nutrient)for 6 months to 3 years age group of reputed brand, cattle feed, wheat bran, rice bran, other items, toilet soap (small), hand wash (500ml), hand wash (250ml/100ml), sanitizer (500ml), sanitizer (200ml/100ml), sanitary pad (6/8 piece), mask (surgical), mask (triple layer), mask (n 95), plastic mug (1ltr), bucket, dustbin (big), dustbin (medium), phenyl, disposable glass/plate, mosquito coil, mosquito net (single/medium/double), baby clothes, blanket (single/double), bed sheet (single/double), sauce pan, kadhai, knife, candle, hurricane lamps, tarpaulin, polythene sheet, empty cement bag, mineral water, detergent powder, bleaching powder, torch light with batteries, led bulb(9/15/18/30 watt), rain coat, gum boot

CTN :39946745

29 Apr, 2025 NA

Silvassa - Gujarat

Tender For supply of trichophyton agar 4 , trichophyton agar 5 , trichophyton agar 6 , grams stain kit , ppd injection for m test , reagent tips for euphoreia , blood culture vials for adult , blood culture vials for pediatric , tcbs agar , urea agar base , anti-biotic zone scale , wilson blair agar , tellurite blood agar base , agar powder , e-strip vancomycin , e-strip meropenen , e-strip colistin , dermetophyte test , lowenstein-jensen , blood base agar , robertson cooked meat , bile esculin azide agar modified , alpha nephthol 100 g , p.h meter , methanol 500 ml , puo screen , susceptibility tigecycline , susceptibility erythromycin , susceptibility azithrothromycin , susceptibility teicoplanine , susceptibility minocycline , susceptibility cefoperazone , susceptibility sulbactum , ast n407 , cryotubes preservaton box , felix test tube , dreyer test tube , test tube 27 ml with screw cape , manitol salt agar , candida diffrential agar base , nalidixic selective supplement , cetrimide agar base , urea 40 , xylose lysine deoxycholate agar , selenite broth , nutrient broth 500 , todd hewitt broth 500 , macconkey broth , macconkey broth purple , alkline peptone water , brain heart infusion broth , metaloop-sl , gas pack , susceptibility ticarcillin , susceptibility benzylpenicillin , susceptibility pefloxacin , susceptibility trimethoprim , susceptibilit ertapenum , lugols iodine , brucella agglutination test , brucella igm antibody elisa , rtpcr primers , ethanol,high purity , iso propyl alchol , ultrapure , megnetic stand , durham tube , fontaba stain , hav elisa detection , hev elisa detection , advia cenatur cal a , advia centaur cal c , adviacentaur cal q , cal b , advia centaur multi-diluent 1 , advia centaur multi-diluent 2 , advia centaur vit b12 , sample tips , cuvettes , sample cups , centaur cp reagent 1 and 2 , advia centaur xp wash , cleaning solution , t3 t4vit.b12 ancillary reagent , vit b 12dtt releasing agents , advia centaur t3 , advia centaur t4 , advia centaur tsh , advia centaur ft3 , advia centaur ft4 , advia centaur vit. , advia centaur fsh , advia centaur lh , advia centaur prl , advia centaur , advia centaur pct , advia centaur ferritin , advia centaur il-6 , advia centaur il6 qc , advia centaur ancillary probe wash , advia centaur pct qc kit , advia centaur probe wash 3 , liphocheck immunoassay plus , hgb timepac cn-free , diff timepac , advia sheath rinse , advia ez wash , test point complete normal , test point complete high , test point complete low , advia opti point , advia set point calibrator , ex-ds reagent , ex-ds wash solution , integrated multisensor cartridge , imt standard a , imt standard b , imt flush solutio , salt bridge solution , imt sample diluent , imt dilution check , thermal printer roll , pre-heparinized abg syringe , rp 500 test cartridge , rp 500 wash waste cartridge trichophyton agar 4 (m534-500g), trichophyton agar 5 (m535-500g), trichophyton agar 6 (m536-500g), gram's stain kit 4x100ml (k001l-1kt), ppd injection for m test 10 tu/01 ml, reagent tips for euphoreia 4.1 (800 ul), blood culture vials for adult (aerobic) (1 vials), blood culture vials for pediatric (1 vials), tcbs agar (m189-100gm), urea agar base (m112s-100mg), anti-biotic zone scale (pw096), wilson blair agar (m331-100gm), tellurite blood agar base (mi260-50gm), agar powder (500gm)(rm301-500g)), e-strip (vancomycin)(em060-10st), e-strip (meropenen)(em080- 10st), e-strip (colistin)(me020-10st), dermetophyte test bid details/ 2 / 115

Central Government/Public Sector

CTN :39971076

10 May, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for physics laboratory - rpmi1640 medium. hepes modifcation with l glutamine and 25mm hepes without sodium bicarbonate powder suitable for cell culture , fetal bovine serum non-usa origin sterile fltered suitable for cell culture , ethanol absolute. for analysis emparta acs , trypsin from porcine pancreas lyophilized powder bioreagent , thiazolyl blue tetrazolium bromide powder bioreagent suitable for cell culture suitable for insect cell culture , trypan blue solution , corning syringe flters , lb broth with agar , lb broth miller highly- referenced nutrient-rich microbial growth powder medium suitable for regular e coli culture , ethylene glycol analytical standard , ethylenediaminetetraacetic acid acs reagent , zinc acetate , polyvinylpyrrolidone mol wt number average molecular weight , gadolinium iii nitrate hexahydrate , chromium iii nitrate nonahydrate , cadmium chloride , n n dimethylformamide acs reagent , i sodium citrate anhydrous emprove essential , ascorbic acid , hydrogen peroxide solution , hydrazine hydrate solution , tetra-n- butyl orthotitanate , ferric nitrate nonahydrate , magnesium nitrate hexahydrate , samarium iii nitrate hexahydrate , acetic acid , poly vinyl alcohol pva , samarium iii oxide , niobium v oxide , molybdenum iv oxide , samarium powder for synthesis , cobalt ii chloride anhydrous , nickel ii chloride , lithium chloride , hydrofluoric acid , silver nitrate solution , ammonium hydroxide solution , silicon nanoparticles bid number/ & ( * ) : gem/2025/b/6128335 dated/ + : 09-04-2025 bid document/ 3 3 1 / 35

State Government

CTN :39919589

19 Apr, 2025 NA

Patiala - Punjab

Tender For lab kits consumables and other items for rajindra hospital patiala - paper roll, pti kt, g6pd kits, methanol 2.5ltrs bottles, leishman stain powder (bottel), 10% sodium hypchlorite (liters), liquid paraphin (bottels), retic stain (bottels-125 ml), spirit (liters), test tubes, micro capillary tubes (box ), slides (box), westergren pipttes, edta vaccutainers, plain vaccutainer, sodium flouride, pti vaccutainer, esr vaccutainer, urine containers, syringe (20ml), syringe (10ml), syringe (5ml), syringe (2ml), disp.gloves( 7.5), disp.gloves( 7.00), disp.gloves( 6.5), cotton (bundles), bone marrow needle (no.14, bone marrow needle (no.16, bone marrow needle (no.18, jamshidi needle, lignocane 2% 30ml (bottels), micropore (pc), betadine (bottles), urine strips (box), nitrile gloves (box), blotting sheet 2 bundles (1000 sheets ) boxes, cover slip boxes, gentamicin 120mg hlg (vials), ceftazidime + clavulanic acid (30mg+15mg) (vials), ciprofloxacin (30 mg) (vials), ceftriaxone (30 mg)(vials), teicoplanin (30mg) (vials), azithromycin (30mg) (vials), cefoperazone + sulbactam (30 mg+15mg) (vials), nutrient agar (500 gms) boxes, potato dextrose agar (100 gms) boxes, nutrient gelatin (100gms) boxes, of basal media (100 gms) boxes, nitrate broth (100gms) boxes, cled agar with andrade s indicator (500gms) boxes, corn meal agar (500 gms) boxes, hi chrome candida differential agar (100gms) boxes, dextrose (500gms) boxes, sucrose (500gms) boxes, mannitol (500gms) boxes, lactose (500gms) boxes, acetone (litre x 5), lead acetate (500 gm), acid carbolic (500 gm), acid sulphuric (2.5l ), acid acetic, disodium hydrogen phosphate (500 gm), ferric chloride ar (500 gm), glycerine (500 gm), toluidine (gm), i- phenylalanine (500 gm), neutral red (125 gm), acid fuchsin ( 25 gm), basic fuchsin (25gm), potassium tellurite (25gm), sodium taurocholate (500 gm), sodium hydroxide (500 gm), di potassium hydrogen orthophosphate (500 gm), methyl red reagent (100ml), andrade s indicator (100ml), alpha napthylamine (500gm), potassium iodide (100gm), sulphanillic acid 0.8% (100 ml), n, n, n ,n- tetramethyl-p-phenylenediamine dihydrochloride (5g), potassium hydroxide (500gm), widal test kit 4x5ml (to,th,ah,bh) (kits ), crp latex slide agglutination kit (50 tests), ra latex slide agglutination kit (50 tests), aso latex slide agglutination kit (50 tests, ppd 5 tu/ 0.1 ml & 10 tu/0.1 ml (vial), upt strip test, toxoplasma strip test, rpr strip test, hav rapid card, hev rapid card, hep b core antibody igm and igg elisa, rubella igm elisa, cmv igg elisa, hsv-1&2 igm - elisa, petri dish 3 (pc), petri dish 4 (pc), petri dish 4"disposable (pc), durhams tube, over slips (20 boxes (400 packets), blood culture bottles (50ml) 1367019 (bottles), blood culture bottles (160ml) 1367019 (bottles), whatman filter paper rim, filter paper rim (ordinary) (rim), gloves (pair), masks (disposable ), heating elements (autoclave) (elements), insulin syringes, t3 (96 wells), t4 (96 wells), tsh (96 wells), vitamin d 3 (96 wells), lh (96 wells), fsh (96wells), prolactin (96 wells), testosterone (96 wells), psa (96 wells), ca-125 (96 wells), cea (96 wells), ca-15.3 (96wells), alpha fetoprotein (afp) (96wells), ca-19.9 (96 wells), ferritin (96wells), insulin (96 wells, beta hcg (96 wells), amylase, cpk-mb (20x1.1 ml), ldh (20x1.1 ml), cpk total(ck-nac) (15x1.1 ml), phosphorous (2x50 ml), calcium (2x50 ml), micro protein kits for csf (1x50 ml), blood urea kit (2x1 litre), uric acid (4x50 ml), cholestrol 5x20ml, triglycerides 5x20ml, sgot 5x20, sgpt 5x20, alp 5x20 ml, glucose 2x200 ml, total bilirubin 4x50 ml, ammonium sulphate 500gm/(ar) ( packs), disodium phenyl phosphate 100gm per pack (ar) ( packs), trichloracetic acid (tca) ar 500gm ( packs), methanol (ar) 2.5 ltr per pack ( packs), trisodium citrate (ar) 500gm per apck ( packs), methylated sprit (ar) 5lrt per apck ( packs), sodium dihydrogen phosphate (nah2po4) (ar) ( packs), sulphur powder ar 500gm per pack ( packs), liquor ammonia ar 250 m

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Nutrient Tenders

By Cities

By States

By Agencies

By Ownerships

By Sectors

Central Government/Public Sector

State Government

Central Government/Public Sector