Latest nutrient Tenders | Government nutrient Tenders

Central Government/Public Sector

CTN :39896960

23 Apr, 2025 NA

Raigad - Maharashtra

Tender For supply of silicon selant , silicon selant gun , regular isulation varnish , valcunising tape , galvanising compound , electronic component clearner , grease , tarpauline black , tarpauline blue , 1 polythene sheet , 2 polythene sheet , 1 polypropelyne rope , 2 polypropelyne rope , 3 polypropelyne rope , 1 pencil cell , 2 pencil cell aaa , carbon tertra cloride , silica gel , thinner , crc , drill bit 5 mm , drill bit 8 mm , drill bit 10 mm , m seal , rustolyne , red oxide , paint black , paint dark grey , paint orange , paint yellow , paint white , paint blue , paint red , nut bolt m8 x 65 mm , nut bolt m10 x 30 mm , nut bolt m10 x 40 mm , nut bolt m5 x 30 mm , nut bolt m5 x 35 mm , nut bolt m8 x 40 mm , nut bolt m24 x 60 mm , nut bolt m16 x 70 mm , nut bolt m24 x 65 mm , nut bolt m 16 x 70mm , 9 v cell

CTN :39852354

04 Apr, 2025 1.70 Lacs

Bhopal - Madhya Pradesh

Tender For supply of laboratory items and spares for idgah hills laboratory under zone no.02 - edta n/50 500 ml, sulphuric acid n/50 500 ml, ammonia buffer solution b 500 ml, 0.0141 silver nitrate solution 500 ml, o.t. solution 500 ml, tissue paper roll, 100 ntu(turbidity meter calibrator)500m(make sigma aldrich) 500 ml, glass dropper bottle 250 ml, amber colour burette 50 ml, mannual pipette controller 10ml, conical flask cleaning brush, test tube cleaning brush, breaker cleaning brush, reagent bottle cleaning brushcompatible with 250ml,500ml,1000ml and 2000ml regent bottle, breaker 500ml, membrane filter apparatus(for totalcoliform and ecoli test)including an electric vaccum pump,a vaccum flask(e.g.an erlenmeyer side arm flask)and a filter support, residual glass petri dish 60mm x 15mm, blunt ended forceps, membrane filter with nutrient absorbentpads 47mm in diameter with a pore diameter of 0.45 micro meter singlypacked pre sterlized membranes nutrient absorbat discs about 1 mm thickwith the same diameter as the membrane filters, m7 fc agar 500g, free chlorine low and medium rangetest kit with checker disc.(chloroscope)

CTN :39828784

03 Apr, 2025 NA

Hyderabad-T - Telangana

Tender For supply of ampicillin 10 mcg 5x50 disc catridge himidia make only , cloxacillin 5 mcg 5x50 disc catridge himidia make only , cefazolin 30 mcg 5x50 disc catridge himidia make only , cefatoxime 30 mcg 5x50 disc catridge himidia make only , cefpdoxime 30 mcg 5x50 disc catridge himidia make only , erythroumycin 15 mcg 5x50 disc catridge himidia make only , gentamycin 30 mcg 5x50 disc catridge himidia make only , nalidixic acid 30mcg 5x50 disc catridge himidia make only , ofloxacin 10 mcg 5x50 disc catridge himidia make only , amikacin 30 mcg 5x50 disc catridge himidia make only , vancomycin 30 mcg 5x50 disc catr himidia make only , tazoba/piper 10/100 mcg 5x50 disc catr himidia make only , augmentin 30 mcg 5x50 disc catridge himidia make only , cefuroxime 30 mcg 5x50 disc catridge himidia make only , lomefloxacin 10 mcg 5x50 disc catridge himidia make only , cefp/tazob10/100mcg 5x50 disc catr himidia make only , ciprofloxacin 5 mcg 5x50 disc catridge himidia make only , cephalexin 30 mcg 5x50 disc catridge himidia make only , ceftriaxone 30 mcg 5x50 disc catridge himidia make only , cotrimoxazole 25 mcg 5x50 disc catr himidia make only , nitrofurantoin 300 mcg 5x50 disc catr himidia make only , linezolid 30 mcg 5x50 disc catridge himidia make only , norfloxacin 10 mcg 5x50 disc catridge himidia make only , tetracycline 30 mcg 5x50 disc catridge himidia make only , azithromycin 15 mcg 5x50 disc catridge himidia make only , ceftazidime 30 mcg 5x50 disc catridge himidia make only , doxycycline 30 mcg 5x50 disc catridge himidia make only , levofloxacin 5 mcg 5x50 disc catridge himidia make only , meropenem 10 mcg 5x50 disc catridge himidia make only , amoxycillin 10 mcg 5x50 disc catridge himidia make only , chloramphenicol 30 mcg 5x50 disc catr himidia make only , cefixime 5 mcg 5x50 disc catridge himidia make only , penicillin 10u 5x50 disc catridge himidia make only , blood agar base 500 g. himidia make only , mac conkey agar 500gms himidia make only , glucose broth ( m860) 500g himidia make only , mueller hinton agar 500gms himidia make only , sterility testing medium a m017 500g himidia make only , agar agar ( grm 666) 500g himidia make only , robertson cooked meat medi m149 500g himidia make only , zn stain kit-himedia k005l (500 ml) , himidia make only , potassium permanganate himeda 500g himidia make only , formaldehyde solution 500ml himidia make only , inoculation loop ss4 metaloop la014 himidia make only , microtip stands (box with lid) 0-1000 l eppendorf make only , microtip stands (box with lid) 0-100 l eppendorf make only , autoclave t tube racks 30t tubes rack ria/ qualigens/ thermo fisher makes only , petri plates ria/ borosil/ sigma/ bello / abgil makes only , eto sterile swabs qualigens/ jonson/ thermo fisher/ himidia , makes only sterile containers , himidia/ borosil/ abgil makes only nutrient broth 500gms , himidia make only brain heart infusion agar 500gms , himidia make only mac conkey doub strength broth m539 500g , himidia make only fluid thioglycollate broth m009 500g , himidia make only sabouraud s dextr agar mediu mh063 500 , himidia make only anaerobic blood agar base med m1345 500 , himidia make only grams stain kit-himedia k001 (500 ml) , himidia make only lactophenol cotton blue () 125 ml , himidia make only barium chloride dehydrate 500g , himidia make only gelatin ( grm019) 500g , himidia make only nutrient agar ( m001) 500g himidia make only

Central Government/Public Sector

CTN :39835162

16 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals for animal science lab - potassium hydroxide 1000 g , 4 percent paraformaldehyde 500 ml , phenol chloroform isoamyl alcohol 300 ml , sodium carbonate 500 g , thiobarbituric acid 125 g , sodium hydroxide 1000 g , superoxide dismutase antioxidant assay kit calorimetric 1 , riboflavin 100 g , trypan blue zero point four percent solution 50 ml , guaiacol 250 g , iron chloride fecl3 100 g , potassium ferricyanide 100 g , iodine 100 g , dichloromethane 100 ml , iron sulfate feso4 500 g , sodium hypochlorite naocl 500 ml , perchloric acid hclo4 500 ml , zinc chloride zncl2 500 g , sodium iodide nai 500 g , phosphate buffer 500 ml , dna extraction kit for animal tissue 2 , pcr kit 2 , pbs phosphate buffered saline 1000 ml , sodium chloride 1000 g , bouins fixative 500 ml , bradford reagent 1000 ml , alt activity kit calorimetric 50 rxn , ast activity kit calorimetric 50 rxn , alp activity kit calorimetric 50 rxn , giemsa stain 50 ml , ethanol 15 l , nitroblue tetrazolium nbt 25 g , s acetylthiocholine iodide 25 g , potassium cyanide 500 g , drabkins reagent 500 ml , hayemis rbc diluting fluid 100 ml , turks wbc diluting fluid 100 ml , heparin anticoagulant 50 ml , hydrogen peroxide 1500 ml , 1 chloro2 4 dinitrobenzene cdnb ar 100 g , glutathione reduced gsh 25 g , two point five percent glutaraldehyde 500 ml , diethyl ether ar 1000 ml , petroleum ether ar grade 2500 ml , pyrogallol 100 g , nitric acid 1000 ml , perchloric acid 1000 ml , glacial acetic acid 1500 ml , l tryptophan extrapure 100 mg , barium chloride dehydrate 500 g , gum acacia 500 g , magnesium chloride hexahydrate 500 g , potassium nitrate 500 g , methyl cellosolve 1000 ml , citric acid 500 g , sodium citrate tribasic dehydrate extrapure 98 percent 500 g , anthrone acs 98 percent 25 g , n propanol 1000 ml , ammonium metavanadate 100 g , phenol crystalline extrapure ar 500 g , boric acid 500 g , papain 100 g , ferric chloride hexahydrate a 100 g , starch 1000 g , donepezil hydrochloride 1 , master mix pcr 100 rxn , dpph 2 g , atbs 5 g , ctab 3 kit , mcnkey broth 500 g , mha muller hinton broth 500 g , sterile disc 2 pack , plate count agar 500 g , m17 agar 500 g , m17 broth 500 g , ox bile ox gall 500 g , mha agar 500 g , mrs broth 1000 g , mrs agar 1000 g , pepsin and cysteine 25 g each , x gal 5 bromo 4 chloro 3 indolyl beta d galactopyranoside 1 g , 10 micro leter iptg iso propylthio beta d galactopyranoside 5 g , columbia agar 500 g , dna extraction kit for bacteria 1 pack , molecular primer 27f 5agagtttgatcctggctcag 3 and 1492r 5 tacggtaccttgttacgactt3 , wurster reagent n n n n tetramethyl pphenylenediamine 10 g , sucrose lactose maltose glucose fructose xylose sorbitol 500 g each , d arabinose 100 g , d reffinose 100 g , gram staining kit 200 ml reagents , trypsin 10 g , nutrient agar 500 g , nutrient broth 500 g bid details/ 2 / 76

Central Government/Public Sector

CTN :39774589

12 Apr, 2025 NA

Kangra - Himachal Pradesh

Tender For supply of chemicals and consumables - oxalic acid graterthan 99point5 percent cas 6153-56-6 , 2 4 dinitrophenol 99 percent cas 51-28-5 3x100gm , abts 2 2-azino-bis 3-ethylbenzothiazoline-6-sulfonic acid diammonium salt 30931-67-0 , acetylcholine chloride ar 1 pack of 10 g , ag agcl 3m kcl reference electrode basmf2056-1ea , ag 50w to x8 cat exch resin biotechnology grade 100 to200 mesh hydrogen form , al2o3 pl slurry 0.05meu 1pkt of 10g , al2o3 pl slurry 0.3meu 1pkt of 10g , al2o3 pl slurry 0.5meu 1pkt of 10g , aluminium foil 25micrometer 20 roll per piece 50m , ammonium fluoride ar acs assay 98 percent cas 12125- 01-8 1pack of 25 g , arsenic iii oxide ar assay 99 percent cas 1327-53-3 1pack of 500g , benzofuran for synthesis cas no 271896 b8002-25g , bis salicylaldehyde orthophenylene diamine reagent , bolds basal medium , boron trichloride 178934-100g , bromcresol green cas 76- 60-8 , bromcresol purple ar cas 115-40-2 , bromphenol blue ar cas 115-39-9 , cadmium nitrate tetrahydrate purified assay 99 percent cas 10022-68-1 1pack of 100 , cellulose acetate cas 9004-34-6 , cellulose powder, for column chromatography , centrifuge tube box polypropylene 15ml tarson polylab axiva , centrifuge tubes 50 ml 5 packets 200pc per pack , cetrimide agar , chitosan cas 9012-76-4 , cholchicine 64-86-8 , copper sulphate anhydrous cas no 12852-250g , cresol red ar, cas 1733- 12-6 , cuprous iodide 99 percent cas 7681-65-4 , curcumin grater than equal to 94 percent purity cas no 458-37-7 00280590-10 mg x2 00280590-10mg , curcuminoids 80 percent purity cas no 458-37-7 c7727-500mg , desicator vaccum polypropylene diameter 200mm tarson or polylab , dichloromethane 34856-1ltr , dimethylamine cas 124-40-3 , dmf cas no 68122 , dmso cas no 67-68-5 , dpph cas no 1898664 d9132-5gm , dulbecco phosphate buffered saline d5652-10x1l , eppenndorf-microcentrifuge tubes 1.5ltr , ethanol 99 percent , ethylenediaminetetraacetic acid disodium salt dihydrate , centrifuge tubes 15ml , folin and ciocalteu phenol reagent , formaldehyde cas no 50-00-0 252549-100ml , formic acid gr 98.0-100 percent cas no 64- 18-6 , furan for synthesis assay 99 percent cas 110-00-9 1 pack of 100ml , furfuraldehyde ar acs assay 99percent cas 98-01-1 1 pack of 500 , gallic acid 149-91-7 , glycerol 56-81-5 , graphite fine powder 98percent cas 16940-66-2 , high salt medium , hydrogen peroxide solution 30percent cas 7722-84-1 , icp multi-element standard solution iv sigma merck 23 elements in diluted nitric acid 1000 mg l ag, al, b, ba, bi, ca, cd, co, cr, cu, fe, ga, in, k, li, mg, mn, na, ni, pb, sr, tl, zn , immersion oil , in line syringe filter holder 25mm psf tarson or polylab or axiva , in line syringe filter holder 47mm psf tarson or polylab or axiva , iron oxide cas no 1309-37-1 , l-malic acid 99percent cas 97- 67-6 , lb broth , macconkey agar , mask , methyl diethanol amine cas 105-59-9 , methyl orange cas 547-58-0 3x100gm , methyl red cas 493-52-7 3x100gm , methyl yellow cas 60-11-7 3x100gm , mini spatula , n-methyl-2- pyrrolidone for hplc 99percent , naoh-solid cas no 1310732 6x1kg , neutral red ar cas 553-24-2 , nutrient agar , nutrient broth , p-nitrophenol ar cas 100-02-7 , parafromaldehyde cas 30525-89-4 , petroleum ether cas no 8032324 , phenol red sodium salt indicator cas 34487- 61-1 , phenolphthalein indicator cas 77-09-8 5 x100gm , phenyl boronic acid cas 98-80-6 1pack of 25g , pipette rack horizontal z shape polypropylene tarson or polylab oraxiva , pnpa-paranitrophenylacetate 2 bottle of 25g , polyvinylidene fluoride cas 24937-79-9 , polypropylene beaker garduated 500mltarson or polylab or axiva , polypropylene forcep , polypropylene measuring cylinder graduated class a 500ml tarson or polylab , potassium hydroxide 90 percent flakes 484016-1kg , potassium permanganate 238511-100gm , potassium persulphate 7727-21-1 , potassium sulphate cas no 7778805 223492- 500gm , potato dextrose agar , potato dextrose broth , ptfe stirrer 10 x 250mm , pyrrole for synthesis assay 97.

CTN :39774893

11 Apr, 2025 5.65 Lacs

Darjeeling - West Bengal

Tender For supply of drugs and pharmaceuticals - d ifa re 05 moxifloxacin 0 dot 05 cream tube of 5gm , d ifa re 05 desonide 0 dot 05 w w gel 10gm , d ifa re 05 nepafenac 0 dot 1 eye drop w v with carbomer 970 p eye drop with tainer system 5ml , d ifa re 05 glucose test strip accu check instant s , d ifa re 05 nebivolol 10mg tab , d ifa re 05 mometasone 0 dot 1 w w lotion 30ml , d ifa re 05 iron syp for adult with vitamins each 5 ml contains ferrous fumarrate 100 mg folic acid ip 3mg and vit b12 10 mcg , d ifa re 05 sodium chloride 3 solution for injection bott of 100 ml , d ifa re 05 dextrose 10 in 500ml inj , d ifa re 05 sterile corrugated drains , d ifa re 05 feeding tube 6fr , d ifa re 05 dispo sterile drapes for surgical trolley , d ifa re 05 hydrogen peroxide 3 6 , d ifa re 05 cling drape , d ifa re 05 cath mount , d ifa re 05 fuji dry view laser films 10 8 , d ifa re 05 disposable irrigation aspiration set , d ifa re 05 dispo mersilk no 1 cutting needle 45 mm 1 2 circle needle , d ifa re 05 dispo venous extension line lactospiral 200 cm , d ifa re 05 salicylic acid 2 face wash 60ml , d ifa re 05 infusar bag for epidural analgesic 300ml , d ifa re 05 fosphenytion sodium 150mg 2ml inj , d ifa re 05 dispo prolene polypropylene no 1 40 mm round body needle 75 cm , d ifa re 05 mallinckrodt micro laryngeal oral nasal tracheal tube cuffed size 5 dot 5 mm , d ifa re 05 mallinckrodt micro laryngeal oral nasal tracheal tube cuffed size 6 dot 5mm , d ifa re 05 water seal drainage , d ifa re 05 bimatoprost 0 dot 03 timalol 0 dot 5 eye drop 3ml , d ifa re 05 naloxone 0 dot 4 mg ml inj , d ifa re 05 clobetasolpropinate 0 dot 05 salicylic acid 6 urea10 lactic acid 5 oint 30gm , d ifa re 05 mometazone nasal spray 100 metered dosages 10 ml , d ifa re 05 benzoyl peroxide 4 wash 50 gm , d ifa re 05 chlorhexidine 4 with moisturizer bott of 500 ml , d ifa re 05 surgical hand antiseptic handrub with 1 chlorhexidine in alcohol based solution with moisturizer usfda approved 500 ml , d ifa re 05 fuji dry view laser films 12 10 , d ifa re 05 dolutegravir 50mg lamivudine 300mg tenofovir 300mg , d ifa re 05 shea butter mango butter cocoa butter dimethicone propylene glycol glycerine 75 gm , d ifa re 05 isotonic sodium chloride 0 dot 09 nasal spray 100ml , d ifa re 05 mallinckrodt micro laryngeal oral nasal tracheal tube cuffed size 6 dot 0mm , d ifa re 05 beclomethasone dipropionate 50 mcg and levosalbutamol 100 mcg per metred dose 200 ui inhaler , d ifa re 05 mephentermine 30mg ml inj vial of 10ml , d ifa re 05 folleys catheter double lumen latex 10 fr , d ifa re 05 azelastin 0 dot 1 nasal spray bott of 10 ml , d ifa re 05 sterile disposable monopolar electro cautery pencil pen with lead non stick silicon coated tip and colour coded switches for coagulation and cutting , d ifa re 05 solution minoxidil 5 alcohol free 60ml , d ifa re 05 disposable tourniquet velcro type , d ifa re 05 clobetasol propinate 0 dot 05 lactic acid 12 cream 30gm tube , d ifa re 05 colloidal iron folic acid and vit b12 syp 200ml , d ifa re 05 zinc oxide 25 cream 50gm , d ifa re 05 aloevera calamine pramoxine lot 100ml , d ifa re 05 calamine 8 aloe vera 10 light liquid paraffin10 olivem 800 lot 60ml

CTN :39538928

31 Mar, 2025 NA

Kapurthala - Punjab

Tender For corrigendum : purchase of chemicals - ethanol , methanol , acetone , dimethylformaamide , nmethyl-2-pyrrolidone , 1-ethyl-3-methylimidazoliumacetate , 1-butyl-3methylimidazolium chloride , 1-butyl-3- methylimidazoliumtetrafluoroborate , sulfuric acid , phospric acid , sodium hydroxide , potassium hydroxide , potassium carbonate , nickle on carbon , palladium on carbon 5 wt percent loading matrix activated carbon support , platinum on carbon , ruthenium on carbon , ammonium persulfate , sodium borohydride , glucose , mannose , alkali lignin , organosolv lignin , cyclohexane , benzene , cyclohexanol , toulene , xylene , potassium phostphate monobasic , 2,5-furan dicarboxyylic acid , 5- hydroxymethyl 1-2-furancarboxyylic acid , 5-formyl-2- furancarboxyylic acid , 2,5-diformylfuran , hmf 5- hydroxymethyl 1-2-furaldehyde , levulinic acid , sodium suplhate anhydrous , pyridine , hydrogen peroxide , choline chloride , acetamide , sulfolane , nickel ii chloride hexahydrate , sulfamic acid , lactic acid , ethylene glycerol , p-toluenesulfonic acid monohydrate , aluminimum chloride hexahydrate , aluminimum potassium sulfatedodecahydrate , iron iiichloride tetrahydrate , iron iii chloride hexahydrate , polyvinyl alcohol pva , acrylamide polymer 10 percent in water , polyvinylpyrrolidone , zeolite , alpha aluminum oxide , gamma aluminum oxide , zirconium iv oxide , cerium oxide , silver nitrate , copper nitrate hexahydrate , nickel nitrate hexahydrate , manganese ii nitrate tetrahydrate , cerium nitrate hexa hydrate , zinc nitrate hexahydrate , molybednum iv oxide , magnesium hydroxide , ruthenium chloride hydrate , lanthanum iii nitrate hexahydrate , niobium penoxide , niobium v chloride , monomagnesium phosphate , iron nitrate hexahydrate , silicon dioxide , nickel ii oxide , vandium pentoxide

CTN :39762353

10 Apr, 2025 NA

Jorhat - Assam

Tender For supply of lpo 360 ski 37 - methotrexate sodium 50mg, 2 ml inj , inj secukinumab 150 mg per ml , glycerin or glycerol in bottle of 1 kg , finasteride 1 mg tab , tretnoin microsphere 0.04percent gel, tube of 20 gm , methotrexate sodium 15mg, 1 ml inj , acd-a vacutainer of 9ml , cap lymecycline bp 408 equivalent to tetracycline base 300mg , purified water, glycerin, butyrospermum parkii ,shea butter, cetostearyl alcohol, caprylic capric triglyceride , azelaic acid, mandelic acid, salicylic acid, dipropylene glycol, benzoyl peroxide, d- panthenol, polysorbate-20, , purified water, ethylhexyl methoxycinnamate, benzophenone-3, butylmethoxy dibenzoylmethane, caprylic or capric triglycerides, , purified water, cetostearyl alcohol, glycerin, propylene glycol, cetyl alcohol, isostearyl isostearate, potassium cetyl phosphate, , purified water, glycerin topical, isopropyl myristate topical, paraffin topical, cyclopentasiloxane, dimethiconol, crosspolymer phenyltrimethicone blend, shea butter, , aqua, urea, paraffin liquidium, lactic acid, propylyne glycol, petrolatum, glycerin, cetostearyl alcohol, steareth-2, steareth-21, , fusidic acid cream 2 percent ww 10g tube , fluticasone propionate cream 0.05percent tube of 10gm , gycerin 15percent cream , ear buds for ent use , lactic acid and sodium lactate degreasing lotion , lotion sertaconazole nintrate 2percent , purified water,propylene glycol,cyclomethicone,emulsifying wax,glycerine,shea butter,aloe butter,cocoa butter,mango butter,cetyl alcohol,disodium edta,zinc oxide , dermapen needle , 10- hydroxydecanoic acid, avena sativa oat leaf extract, glyceryl stearate, niacinamide, cetearyl glucoside, cetearyl alcohol, cetyl alcohol, sorbitan isostearate, glycerine, , aloevera 5percent ww, glycolic acid 1percent ww, vit-e 0.1percent ww and bronopol, sodium lauryl sulphate face wash in gel base tube of 100 gm , aqua, glycerin, panthenol, distearyldimonium chloride, petrolatum, isopropyl palmitate, benzalkonium chloride emollient cream, tube of 200 ml , minoxidil 5percent wv with finasteride 0.1percent wv lotion containing butylene glycol, water bott of 60 ml , utmf ceramide iii, dermaxyl, polymethyl siloxane, silicon di oxide, vit c, silicon gel tube of 15 gm , glycolic acid 6percent, urea 20percent, lactic acid 5 percent ww cream base containing cetylated fatty ester, jar of 50 gm , 5percent amorolfine wv medicated nail lacquer , aloe vera 10percent , liq paraffin 10percentand calamine80percent , pimecrolimus 1percent cream , lidocaine 7percent and tetracaine7percent cream , pot permaganate crystal pack of 20 gm , ciclopirox 1percent and zinc pyrithione 1percent shampoo , dressing silicon gel sheet 5inch x 4.5inch , mometasone 0.1percent and fusidic acid 2percent cream , silicone gel adhesive hydrocellular foam dressing sacrum 16.8 x 17.1 cm box of 10 methotrexate sodium 50mg, 2 ml inj, inj secukinumab 150 mg/ml, glycerin (glycerol) in bottle of 1 kg, finasteride 1 mg tab, tretnoin microsphere 0.04% gel, tube of 20 gm, methotrexate sodium 15mg, 1 ml inj, acd-a vacutainer of 9ml, cap lymecycline bp 408 equivalent to tetracycline base 300mg, purified water, glycerin, butyrospermum parkii (shea butter), cetostearyl alcohol, caprylic capric triglyceride, niacinamide, sodium acrylates copolymer, glyceryl stearate citrate, 2-phenoxyethanol, vitamin e acetate, vectorised oxyresveratrol, glycyrrhiza glabra (licorice) root extract, polyglyceryl-3 stearate, lecithin, bid details/ 2 / 35